Unigene SGN-U296312

Unigene Basic Information 
Unigene ID: SGN-U296312
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 296312
mRNA sequence: Length: 219 bp

>SGN-U296312 Solanum tuberosum #4 (1 members)
AGAAGGAACAAAGCCTTGATTACTGAATTAAGCGTCCCTCGCCCTGGTTCAAAAGACCTGTATTTCGAAACTCAATACTCACAGTCATTA
TGGATACAGTGTATGGCTTGCCTGTGGAAGCAAAACTGGTCATACTGGCGTAATCCTGCTTACACTGCAGTCAGATTCATCTTCACAATG
TTCATAGCACTAGTCTTTGGAACAATGTTCTGGGATATT


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
AY450631 AY450631 ABC1 protein mRNA
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E624349
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None