Sol Genomics Network

Unigene SGN-U296473

Unigene Basic Information

Unigene ID:	SGN-U296473
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	296473
mRNA sequence:	Length: 754 bp

>SGN-U296473 Solanum tuberosum #4 (1 members)
TCATTTCTCGTTTTGATGGCTGCTCCACCGGCAAGGGCTCGTGCCGATTACGATTACCTCATTAAGCTTCTCTTGATCGGCGATAGCGGT
GTTGGAAAAAGTTGTCTTCTTTTGCGTTTTTCTGATGGTTCCTTCACTACCAGTTTCATCACAACTATTGGTATTGATTTTAAGATAAGA
ACCATTGAACTTGATGGCAAACGGATCAAGCTCCAAATTTGGGATACTGCAGGACAGGAACGGTTCCGGACAATTACAACAGCTTACTAT
CGTGGTGCCATGGGCATATTGCTGGTCTATGATGTTACTGATGAAGCATCATTTAACAATATCAGGAATTGGATTCGCAACATTGAGCAA
CATGCTTCGGATAATGTTAACAAAATACTGGTAGGGAACAAAGCAGATATGGACGAAAGCAAAAGGGCTGTGCCAACTTCCAAAGGCCAA
GCACTGGCTGATGAGTATGGAATCAAATTCTTCGAAACTAGTGCAAAGACAAATCTAAATGTGGAGGAAGTTTTTTTTTCCATAGCAAGA
GACATAAAACAAAGGCTTGCTGACACTGACAACAAGGCAGAGCCAACAACCATCAAAATCAACCAAGACTCTGCAACGGGGTCTGGACAG
GCTGCACAAAAATCTGCTTGCTGTGGTTGAGGACACTTTTACAAGTTGGTGGCAACATTATTGAAGAAATTACTTGTATGATAATCATGA
TGCTGACTTGTGCTCAACGTTTTCAATGTGGCAT

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	cSTS	sprouting eyes from tubers 12-14 weeks post harvest	9230	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E451126
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	14	Ras_trnsfrmng	471
2	21981	Ras_trnsfrmng	310
5	56261	Ras_trnsfrmng	245
1.1	101377	Ras GTPase - Molecular Function: GTP binding (GO:0005525) - Biological Process: small GTPase mediated signal transduction (GO:0007264)	504
2	118418	Ras Ras GTPase - Molecular Function: GTP binding (GO:0005525) - Biological Process: small GTPase mediated signal transduction (GO:0007264)	280
5	128935	Small GTP-binding protein domain - Molecular Function: GTP binding (GO:0005525) Ras Ras GTPase - Molecular Function: GTP binding (GO:0005525) - Biological Process: small GTPase mediated signal transduction (GO:0007264) Ras small GTPase Rab type - Molecular Function: GTP binding (GO:0005525) - Biological Process: small GTPase mediated signal transduction (GO:0007264) - Biological Process: protein transport (GO:0015031)	203

Preceding Unigenes (1)

Unigene	Build
SGN-U262447	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer