Unigene SGN-U296943

Unigene Basic Information 
Unigene ID: SGN-U296943
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 296943
mRNA sequence: Length: 671 bp

>SGN-U296943 Solanum tuberosum #4 (1 members)
AAAACACACACACAAACAAAAAAGACAGGGGTGATTTGATCTTAAAGAACATATAGTGCAAAATGGCAAGAAAGTTTAGTACTTTAGTTG
TTTTTGGTGCAATTTTATTTGCTTTATTACAACATGTTTCAATGGCACAACAAACTCATGTTGTTGGTGATACTTTGGCTTGGACCGTTC
CTAATGGTGGCGCTGCCTCTTATTCCACCTGGGCCGCTGGGAAAACCTTTGCCCTCGGTGACGTTCTTGTATTTAACTTTAGAACTGGAT
CACATAGTGTGGCTGAAGTGTCAAAAGGAGCTTTTGATTCATGCAATACTTCAAGCCCAATTTCAATTTCAACTAATGGCCCAACAAATA
TTACATTGACCACTGTTGGATCACATTACTATCTTTGTACATTTCCAAGCCATTGTACATTGGGCCAGAAATTGGCTATTAACGTCTCCG
GCTCCGCGTCTCCCGCTCCTCAGCCAGCCCCCGNCACTCCNACCAACAACAACCCGAGTGAATGGCTCCAAGCCCCATCCGTGTCAGGTC
GCTCCAGCAACGGCACCTGCACCTACTAGTGTAGCCCAAACTTATATTGGTCGGAGATAACTTGGCGCTGGAGTGTTCCTACTAGTGGCC
AAATACTTATCAAAGATTGGGCTAATGGCAAATCATTTCAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
bcp1 dicyanin blue copper protein (bcp1 gene)
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E576165
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)