This unigene is from an out-of-date build,
Coffea canephora #1
It has been superseded by SGN-U614160 in the current build, Coffea canephora #3
It has been superseded by SGN-U614160 in the current build, Coffea canephora #3
Unigene Basic Information |
Unigene ID: | SGN-U305475 |
Unigene Build: | Coffea canephora #1 |
Date: | 2005-04-24 |
Organism: | C.canephora |
Alternative ID: | 128712 |
mRNA sequence: | Length: 124 bp |
>SGN-U305475 Coffea canephora #1 (1 members)
GCCAACTCTGAAGGAAATGCTTTGCATGCTCTGATAAGGATACTTTTTGACCCCAAGATGTTCTGCAGAGCTGGGACCCTACTCTGGTTA
ATCCTTGTACTTGGGATCATGTCGCATGTGACTC
[Blast] [AA Translation]
Associated Loci (0) |
Genomic locations (0) |
![]() |
![]() |
[Show Image]
![]() |
![]() |
![]() |
![]() |
![]() |
Preceding Unigenes (0) |