Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U580929 in the current build, Tomato 200607 #2

Unigene SGN-U312327

Unigene Basic Information

Unigene ID:	SGN-U312327
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	312327
mRNA sequence:	Length: 836 bp

>SGN-U312327 Tomato 200607 #1 (69 members)
GTAAAGGAGGGCGGCTCGCTACAGCATCAACCATGGTTCTCAAGACAGAACTTTGCCGTTTCAGTGGTGCCAAGATTTACCCTGGGAGAG
GCATCAGATTTATCCGGTCAGACTCTCAGGTGTTCCTATTCGTCAACTCAAAATGTAAACACTACTTCCACAACAAGTTGAAGCCATCCA
AGCTTACATGGACAGCTATGTATAGGAAGCAACACAAGAAGGATATTGCACAAGAAGCTGCTAAGAAGAGGCGACGTACCACCAAGAAGC
CTTACTCTAGGTCTATTGTGGGTGCAACCTTGGAGGTAATCCAGAAGAAGAGAACTGAAAGGCCAGAAGTTCGAGATGCTGCCAGGGAGG
CTGCTCTTCGTGAAATTAAGGAAAGGATCAAGAAGACAAAGGATGAAAAGAAGGCTAAGAAAGCAGAGGTTCAGGCCAAGTCTCAGAAAG
CTGGAGGAAAGGGCAATATGTCCAAAGGAGGTGCATCAAAAGGTCCTAAGCTTGGTGGTGGCGGAGGAAAACGTTAAGCTGTTGTTTATG
TTGTTTCCTTATTAGCAATAGAGTGCCTTGTTTGAAGAGACTGTAAGCGGAGACCTTCATTTACAAGTATCTCATACATCTGCAGACAAA
TTTCTCGTTGACGGTTTTGCATTTGGTTGCAAATGCAGCTGTTGATTCTCCACATACTATTGACTTCTTGTGGGTTCATTCTCTATTACA
GATGTAGCTTTTTGACTCCTAAACAAAATATTTTTGAAATCTGTTTCTTCGAAAAAAAAAAAGTAATTTACCATGCAGCAATCTGTTTTC
CTGCGTAAAAAAAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (25)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum pennellii	cLPP	pollen pollen collected from open flowers	5426	2
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	3
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	1
Solanum lycopersicum	LB	Leaf Mature leaves	3316	1
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	1
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	2
Solanum lycopersicum	cLEE	seeds and maturing carpels 5 days post-anthesis to fruit over-ripe stage	547	1
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	1
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	1
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	1
Solanum lycopersicum	cLEN	fruit pericarp red ripe to over-ripe	3979	1
Solanum lycopersicum	cLER	leaf 4 weeks	5127	4
Solanum lycopersicum	cLES	leaf 4 weeks	5243	6
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	2
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	7
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	3
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	2
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	2
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	1
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	8
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	4
Solanum lycopersicum	cTOS	suspension cultures	8026	7
Solanum lycopersicum	t3_tus	Rearrayed collection of L. esculentum cDNA clones	1883	2
Solanum lycopersicum	vSlycmRNA		8362	1
Solanum habrochaites	LH_Ea	Glandular Trichomes	3840	5

mRNA member sequences (69)

Alignment image suppressed for unigene with 69 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 1 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101941	Ribosomal protein L24E - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	28
2	119008	Ribosomal protein L24E - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	23
5	129386	Ribosomal protein L24E - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	23

Preceding Unigenes (1)

Unigene	Build
SGN-U213096	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer