Sol Genomics Network

Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U581466 in the current build, Tomato 200607 #2

Unigene SGN-U312488

Unigene Basic Information

Unigene ID:	SGN-U312488
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	312488
mRNA sequence:	Length: 909 bp

>SGN-U312488 Tomato 200607 #1 (23 members)
GTAGATCCGAGGAGTTTTTGTAAAACTGCAGTCTTTGAAAACCCTAATTCTCAAATCTTTCAGATCTTTCTTTGACAAACTTCAAATCAC
CATCAATCATGGCAGCAGAAGGTTCTCAGTTTGATGCTCGTCAATTCGATGCAAAAATGACAGAACTGCTTGGTACTGAACAACAGGAAT
TCTTCACATCATATGATGAGGTTCACGACAGTTTTGATGCCATGGGTTTGCAAGAAAATCTCCTGAGGGGCATCTATGCCTATGGTTTTG
AGAAGCCATCTGCTATTCAGCAAAGGGGCATTGTTCCTTTTTGCAAGGGCCTTGATGTCATCCAGCAGGCACAATCTGGTACTGGAAAGA
CGGCAACTTTCTGCTCTGGAATTCTCCAGCAGCTTGATTACAGTTTAGTTGAGTGTCAGGCTCTGGTTCTTGCACCAACCCGTGAGCTTG
CACAACAGATTGAGAAGGTTATGAGAGCACTTGGTGACTACCTGGGTGTGAAGGTTCATGCTTGTGTTGGGGGTACCAGTGTCCGTGAGG
ATCAGCGCATCCTTCAGAGCGGTGTTCATGTTGTGGTTGGTACTCCAGGCCGTGTCTTTGACATGTTGCGCAGGCAGTCTCTTCGCCCCG
ACCACATCAAGATGTTTGTTTTGGATGAAGCTGACGAAATGCTCTCTAGAGGTTTCAAGGATCAGATTTATGATATATTCCAGCTTTTGC
CACCAAAAATCCAAGTGGGTGTTTTCTCTGCGACTATGCCACCAGAGGCTCTTGAGATTACTAGAAAGTTCATGAACAAGCCTGTGAGAA
TTCTCGTGAAGCGTGATGAGCTCACTCTTGAAGGTATTAAGCAGTTTTATGTCAATGTCGATAAAGAAGAGTGGAAGCTTGAAACACTAT
GTGATCTTT

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (11)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	3
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	3
Solanum lycopersicum	LA	Leaf Mature leaves	6589	2
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	1
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	3
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	2
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	1
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	1
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	4
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	1
Solanum lycopersicum	cTOD	flowers anthesis-stage flowers from full grown plants	5642	2

mRNA member sequences (23)

Alignment image suppressed for unigene with 23 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 1 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101393	DEAD/DEAH box helicase N-terminal - Molecular Function: nucleic acid binding (GO:0003676) - Molecular Function: helicase activity (GO:0004386) - Molecular Function: ATP binding (GO:0005524) DEAD/DEAH box helicase - Molecular Function: ATP binding (GO:0005524) - Molecular Function: ATP-dependent helicase activity (GO:0008026)	340
2	118423	Helicase C-terminal - Molecular Function: nucleic acid binding (GO:0003676) - Molecular Function: helicase activity (GO:0004386) - Molecular Function: ATP binding (GO:0005524) DEAD/DEAH box helicase N-terminal - Molecular Function: nucleic acid binding (GO:0003676) - Molecular Function: helicase activity (GO:0004386) - Molecular Function: ATP binding (GO:0005524) DEAD/DEAH box helicase - Molecular Function: ATP binding (GO:0005524) - Molecular Function: ATP-dependent helicase activity (GO:0008026)	248
5	129042	Helicase C-terminal - Molecular Function: nucleic acid binding (GO:0003676) - Molecular Function: helicase activity (GO:0004386) - Molecular Function: ATP binding (GO:0005524) DEAD/DEAH box helicase N-terminal - Molecular Function: nucleic acid binding (GO:0003676) - Molecular Function: helicase activity (GO:0004386) - Molecular Function: ATP binding (GO:0005524) DEAD/DEAH box helicase - Molecular Function: ATP binding (GO:0005524) - Molecular Function: ATP-dependent helicase activity (GO:0008026)	54

Preceding Unigenes (1)

Unigene	Build
SGN-U213505	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer