This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U579787, SGN-U581281, and SGN-U593109 in the current build, Tomato 200607 #2
Unigene SGN-U312572

Unigene Basic Information 
Unigene ID: SGN-U312572
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 312572
mRNA sequence: Length: 1139 bp

>SGN-U312572 Tomato 200607 #1 (271 members)
ATCACAAAATTATCTAAAACATATTGACCCTCCAACATCACCATTGTAACAAAGAATTGGAAAATCCATTCCCAAAACCAAACCAAAGAG
AGTAATTGAGCAATGGCTGCTTCCACACAATGTTTCTTGCACCAATATCATGCACTAAGATCTAGCCCTGCTAGAACATCCTCTGTTTCA
TCTCCTAAGCCTAACCAATTGATTTGCCGTGCACAAAAGCAAGATGATGCCAGCAACGCCGCCGTCTCGAGACGATTGGCTCTTACTCTC
CTCATTGGTACTGCTGCCATTGGTTCCAAGGTTTCCCCTGCAGATGCTGCCTATGGAGAAGCTGCAAATGTTTTTGGTAAGCCAAAGGAA
AACACTGATTTCTTGCCATACAATGGAGATGGATTCAAGCTCCAAGTCCCAGCCAAATGGAACCCCAGCAAAGAAGTTGAGTACCCTGGT
CAGGTTCTCAGATATGAAGACAACTTTGATTCCACAAGTAATCTTATTGTTGCAGTTACTCCAACTGACAAGAAGTCCATCACCGACTAC
GGCTCCCCTGAAGAGTTCCTCTCTAAAGTGGACTATCTGCTAGGAAAGCAAGCTTACTTTGGTAAAACTGATTCAGAGGGAGGATTTGAA
TCTGGTGCAGTGGCAACTGCTAACCTGTTGGAGGCATCAAGCGCAACAGTGGGAGGAAAAGAGTACTACTACTTGTCAGTATTGACAAGA
ACTGCAGATGGAGATGAAGGTGGAAAGCACCAGTTGATCACAGCCACAGTGAATGATGGCAAACTTTACATTTGCAAGGCACAAGCTGGT
GACAAGAGATGGTTTAAGGGTGCTAAAAAGTTTGTGGAGAATGCTGCCACTTCTTTCAGTATTGCTTAAGAATGGGAAAACTAAAGAAAA
CCATTATTTAAGTTTGTATGTACTTAGTTCTTCCCCCCTCTACAAAACATATGGTGCTGAGATGAGTTGCTTAATTGGACTTCTTTTTTG
CTCTTTCCAACCAATCCCAAAAATGTTTTTAGACATGTTTCAAGTACTGTTGGAGGAAGCTTAATGTTAATAATTTCATAATCTGTTGAT
GGACAAAAAAAAAAAAAAAAAAAAAAAACCCTGGGGGGGGGGCCGGGACCCCATTTCCC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
psbx psbXphotosystem II 23 kDa protein
Genomic locations (0)None
Library representation (30)  
mRNA member sequences (271)  
Alignment image suppressed for unigene with 271 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (3)  
Annotations (manual: 3 | blast: 2 | go: 4 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (1)