This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U579414 and SGN-U590726 in the current build, Tomato 200607 #2
Unigene SGN-U312654

Unigene Basic Information 
Unigene ID: SGN-U312654
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 312654
mRNA sequence: Length: 1014 bp

>SGN-U312654 Tomato 200607 #1 (181 members)
CGGCCAAATCGGCCGAATTGATATATACATTTCAACAAACATGGGCTACTTGACATCTTCTTTTGTTCTCTTCTTCCTTCTTTGTGTGAC
TTATACTTATGCTGCCACTATTGAGGTACGCAACAACTGTCCATACACCGTTTGGGCGGCATCGACTCCGATAGGCGGTGGTCGACGTCT
CAATCGAGGCCAAACATGGGTCATCAATGCTCCGAGGGGAACTAAGATGGCACGTATATGGGGTCGTACTGGTTGCAACTTTAATGCTGC
AGGCAGAGGTACATGTCAGACTGGTGATTGTGGTGGAGTCTTACAGTGTACCGGATGGGGCAAACCCCCAAACACCCTAGCCGAGTACGC
CTTGGACCAGTTTAGCAACTTAGATTTTTGGGACATTTCTTTAGTCGATGGATTTAATATTCCAATGACTTTTGCCCCAACAAAACCTAG
TGGAGGAAAATGTCACGCAATTCATTGCACGGCCAATATAAATGGTGAATGTCCTCGCGCCCTTAAGGTACCTGGAGGATGTAACAACCC
TTGTACCACGTTTGGAGGACAACAATATTGTTGCACCCAAGGTCCATGTGGCCCTACAGAGTTGTCCAAATTTTTCAAGAAAAGATGTCC
CGATGCTTATAGCTACCCACAAGACGATCCTACAAGCACATTTACTTGCCCTGGTGGTAGTACAAACTATAGGGTTGTCTTTTGTCCTAA
TGGTGTTGCTGATCCAAATTTCCCCTTGGAGATGCCTGCAAGTACTGATGAAGTGGCCAAGTGAATTTGAGTTTCTTCATTTTAAATCGC
CTCAATTAGTCAACTGATCTCTACCGTAATGAAAAATCTTAATAGCTCAGTTTTTTAAATATTCACTTTTACTTTATTGATAAGAGTTCG
TAACAAACTTAAAGACCGGAATAAGAGTTACATCTCATGTGTACTTTTGTCTTAGATGTATAAAACAACAGTGCATTTGAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
np24 NP24 protein precursor
Genomic locations (0)None
Library representation (20)  
mRNA member sequences (181)  
Alignment image suppressed for unigene with 181 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (5)  
Annotations (manual: 2 | blast: 2 | go: 1 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (1)