Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.


This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U579474, SGN-U590589, and SGN-U593063 in the current build, Tomato 200607 #2
Unigene SGN-U312669

Unigene Basic Information 
Unigene ID: SGN-U312669
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 312669
mRNA sequence: Length: 1703 bp

>SGN-U312669 Tomato 200607 #1 (160 members)
TTTTTTTTTTTTTTAAGTTGAAACAATTTTTACTCATCTTTTTATTTTTATTTTTTTCATTAATAACTTCAAAATGTTAGAGCTAGGAAA
TGAACAAAATGGTTACAAAGGGAATCCTCTAAATCAAGCTCACATCAAATAATCTAAACAAATTTGGTGCTTGAGTAAACAAGAAAATAG
AGACACAACGTACTCAATTACAACACATACCCAGTGTAGTCCCACAAGTGGGATCTGGGGAGGGTAGGATGTACGCACACCTTACCCTAC
CTTTGTGAGGTAGAGAGATTGACTTGTTCCCGTTGACCCTCGGCTAACATAGTCGTTCTGCTACTTTTTTAAATCAAAGCTCACACCAAC
TAGTTTACAAAGTTCACTTGAAAATCTTCTTCCTCTTGAACCTTCTAGGGTTTTGTTATCCTCTTCTTACCTACTCTCCTCCATATTTCC
AACAATTTACTCCAGTTGAGAAGAAGAAAAAACTTATCCAAATTCAGAAAAAAAATGGCGTCCACTCAGCTAACAGCATCCTCTATCTCT
GGCAATGGTTTTGCATCCTTTGAAGGGCTCAGGTCCACTTGCATTGTAAAGACCGTATCTTTTGCTCCTTTGAAGCACAACAACAGCAGG
TCTTTTAGTCGTCTTGTTGTCAAGGCGGCTACCACCGTAGCTCCTAAGTACACTACACTTAAGCCTTTGGGCGACAGAGTCTTGGTGAAG
ATTAAGACTGCAGAGGAGAAGACTGTTGGTGGTATCCTACTTCCAGTATCAGTTCAGTCGAAACCTAATGGAGGTGAGGTGGTTGCTGTT
GGGGAGGGTCATTCAGCTGGCAAAACCAAAGTGGACATTAGTGTGAAGACTGGTGCCCAAGTCATCTACTCGAAGTACGCAGGAACTGAG
GTGGAGTTTGATGGATCAAAGCACCTCATTCTGAAAGAGGATGATATTGTTGGTATTCTTGAGACAGATGATGTCAAGGATCTGCAGCCA
TTAAATGACAGAGTCCTAATCAAGGTTGCAGAAGCTGAAGAAAAAACCGCTGGAGGTTTACTGTTGACTGAGGCAGCCAAGGAGAAGCCT
TCAATTGGCACGATTATAGCTGTTGGGCCTGGTCCTCTTGATGAAGAAGGGAACAGGAAACCACTTTCAGTATCCCCAGGAAATACAGTT
CTCTATTCCAAATATGCCGGCAGTGAATTCAAAGGTGCTGATGGATCTGATTATATTACACTCAGGGTGTCTGATGTAATGGCTGTGCTA
TCTTAGTGGGACTATTGAGTTATTCCGTGCCAAAAATTTCAGCAGAGATCTAGGAAGGAGGAAGAGCTGCATCCAACTTTCGAGTGAGGA
GTAATACTCTCTGCAAATTAATGATCAATATCTCAGGTGTAGAATCAATTTTCTGAACTCATTTCTGTTCTTGATTTGAGGAATTAGCCT
TTGGGAATTTTGTATGTCAAAAGATTGAAAACTGCAGACTATGAGAGATTAGCAATAATATTTGCATAATTCACATAAAAAAAAAAAAAA
AAAAAGATGTTTGTCATTTTTGGGATCAAGTTGTATATCCCTAGTCGCTAGTGGATCAAAGAGGTAGCTTATTTCGGGATCGCATTTTTG
GAAGCAAGCTTTAAACAATAGAGCCAATATATATAGGAGAAAATAAAAAGTTGAAGTTCAGCAAAAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (2)  
Locus symbolLocus nameGene activity
Cpn21 chaperonin 21 precursor
TOMAADEHYD aminolevulinic acid dehydrataseaminolevulinic acid dehydratase
Genomic locations (0)None
Library representation (29)  
mRNA member sequences (160)  
Alignment image suppressed for unigene with 160 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (4)  
Annotations (manual: 1 | blast: 2 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (1)