This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U579217 and SGN-U590611 in the current build, Tomato 200607 #2
Unigene SGN-U312673

Unigene Basic Information 
Unigene ID: SGN-U312673
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 312673
mRNA sequence: Length: 2679 bp

>SGN-U312673 Tomato 200607 #1 (47 members)
GCTATACCTTTTTTTTTTTTTCAAGTGGTAACTCAATCAGCCCCCTTGGATCTCTCTTTCACTAGCGTGGCATCACGTTGATTCCGGTTT
TTATTCTCTCTCCGGTCCATCTACTTTTTTCTCCTCTGTATTTCAGAAGAAAAGGTTAACTATGGGTAAGGCAAAAAAAAATATTGAAAA
CATGGAGGAAGGAACCCTGGAGGTTGGAATGGAATACAGGACTGTCTCTGGTGTTGCTGGACCACTGGTTATCCTTGAAAAAGTTAAGGG
ACCTAAGTACCAGGAGATTGTTAATATTCGTTTGGGAGATGGAACAACCCGACGTGGACAAGTTCTGGAAGTTGATGGGGAAAAAGCTGT
CGTTCAGGTTTTTGAAGGAACATCTGGAATTGACAACAAATACACAACTGTGCAGTTTACTGGGGAGGTTTTGAAGACACCTGTCTCACT
CGATATGCTTGGACGCATATTTAATGGTTCTGGAAAGCCAATTGACAATGGTCCTCCTATTTTACCTGAGGCTTACAGGGATATTTCTGG
AAGTTCTATCAACCCCAGTGAGAGAACATATCCTGAAGAGATGATACAGACAGGAATTTCAACAATTGACGTCATGAATTCAATTGCTAG
AGGGCAGAAAATTCCTCTATTCTCTGCTGCTGGTCTTCCTCATAATGAAATTGCGGCTCAGATCTGCCGACAAGCTGGTTTAGTGAAGAG
GTTGGAGAAATCTGAAAATCTTCTTGAGGACAGTGAAGCGGACAATTTTGCCATAGTCTTTGCAGCTATGGGAGTCAACATGGAAACCGC
ACAATTTTTCAAACGCGATTTTGAGGAAAATGGATCCATGGAGAGAGTGACGCTTTTCTTAAATCTGGCAAATGATCCTACAATAGAACG
CATCATTACTCCCAGGATTGCTCTGACCACTGCAGAATATCTAGCATACGAATGTGGGAAGCATGTTCTTGTCATTTTAACTGATATGAG
TTCATATGCTGATGCTCTGCGTGAGGTATCTGCTGCCCGAGAAGAAGTGCCTGGAAGGCGTGGATATCCTGGTTATATGTATACTGATCT
GGCAACGATCTATGAACGAGCTGGGCGTATTGAGGGACGGACGGGTTCCATCACGCAAATTCCAATTCTAACCATGCCAAATGATGATAT
TACGCATCCAACTCCAGATCTTACAGGCTATATCACAGAAGGACAAATATATATAGACCGACAGCTTCATAACCGACAGATATATCCTCC
AATCAATGTACTTCCATCCTTATCTCGGCTGATGAAGAGTGCCATTGGTGAGGGTATGACTAGAAGGGATCATGCTGATGTATCCAACCA
GTTATATGCAAATTATGCCATTGGAAAAGATGTCCAGGCAATGAAAGCTGTGGTTGGAGAAGAAGCACTTTCTTCTGAGGACTTGCTTTA
CTTAGAGTTCCTTGACAAATTTGAGAGGAAGTTTGTCTCTCAAGGAGCTTATGACACCCGCAATATATTCCAGTCACTTGATTTAGCTTG
GACACTTCTTCGCATCTTTCCCCGTGAGCTTTTGCATCGTATCCCAGCAAAGACCCTGGATCAGTATTACAGCCGCGATGCACCTAATTG
ACAGGAAGGAACCATCTTTATACTTTCAAGTCTCTTGTGCAATTCCTTGGTGCAATACATTGGCTTTCCTCTTTGTGCATCTCCTTTTAG
CTCAACAATCAACGAGTTCCCAAAACAAAGGTTCTCCAGTTTCTAAAAGTCAATGCTATTTCTTTGGGAACCAGTCACATCTTGTAATTT
ATCACCTGTTGTGTTGTGTGAGATGCTGCAGCGTATATTGGTTTTGTTTAAATTCCAATAACATTATAGGGGGCTTCTAGGTTTTATGCT
CAGCCGTTTTTATGTATGAAGCAATTTTATTGTTTTTCATGGACTAAAAGCTGATTCTTTTGAATAAAAGATCTTGGTATCAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATGTTGGAGGGGACCCAGGAAGACCTTCCCCCACTTTGGACTCAAAAAAAATCAT
ACACCTCTAATCATTAAAAAAACGAATGAAGGAGAGAAATATCTCAAAACAAATGTTGAGCCTGATCACATTGCATCATGGGTTAAGGAG
TTCAAGGATGGCAAGGTGAAACCTTACAAAAAATCAGAACCTATCCCAGAGGTCAACAACGAACCTGTTAAAGTTGTGGTTGCTGACAAT
TTCCAGGATATGGTTTTCAACTCTGGGAAGAATGTACTCATCGAGTTCTATGCCCCTTGGTGTGGACACTGTAAGCAGTTGGCCCCAATC
CTTGATGAAGTGGCTGTCTCATTTGAAAGTGATGCAGATGTTATGATTGCCAAAATTGATGCTACTGCTAATGATTATTCACAGGGAACT
TTTGAGGTCAAAGGTTATCCTACTCTTTATTTCAAGTCAGCAAGTGGAAAGCTTTTGCAGCATCAAGGTGGGAGGACCAAGGAAGACATT
ATTGACTTTATCCAGAAGAATCGGGATAAAGCTGCAGAGCAAAGTCCGGGAAAAGATGAGCTATAATTTAAGGAAGAAAATGTCTAATGC
AGTTGGCGTTGGCTGCCTTACTGATTTACAACCTCCAGGCAAGTGAGAAGAAAGAAACAAGAGCACAAC


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (17)  
mRNA member sequences (47)  
Alignment image suppressed for unigene with 47 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (7)  
Annotations (manual: 1 | blast: 2 | go: 10 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (2)