Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U580136 in the current build, Tomato 200607 #2

Unigene SGN-U312720

Unigene Basic Information

Unigene ID:	SGN-U312720
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	312720
mRNA sequence:	Length: 1079 bp

>SGN-U312720 Tomato 200607 #1 (73 members)
TTATAAACCCTAACGCATTTCTCTTTTTCTTCTCTCTCAAAATAAAAAAAAACCCTACAGCTCCCTCTTACGAAGCTTAGCTTCGAGTTT
TTCTTCTCATCTTTTCGATAATGGCTTTACCAAACCAGCAAACTGTAGACTATCCAAGCTTCAAGCTTGTTATTGTGGGAGATGGAGGAA
CTGGCAAGACAACATTTGTCAAAAGGCATCTCACTGGTGAATTCGAGAAAAAATACGAACCCACTATTGGTGTGGAGGTTCATCCACTAG
ACTTCTTCACAAATTGTGGGAAGATTCGGTTTTATTGCTGGGATACAGCTGGACAAGAGAAGTTTGGAGGTCTCAGAGATGGTTACTACA
TTCATGGGCAATGTGCAATTATCATGTTTGATGTTACAGCCCGTCTGACCTACAAGAATGTTCCTACATGGCATAGAGATCTTTGTAGGG
TTTGTGAAAACATCCCCATTGTTCTCTGTGGAAACAAAGTTGATGTCAAGAACAGGCAGGTTAAGGCTAAGCAAGTTACCTTCCACAGGA
AGAAAAATTTGCAATACTATGAGATCTCAGCAAAGAGTAACTACAACTTTGAGAAGCCTTTTCTGTACCTTGCCAGAAAGCTTGCTGGGG
ATGGTAATCTTCACTTTGTGGAGTCACCTGCACTTGCTCCCCCAGAAGTACACATCGACTTAGCTGCACAGGCACTGCATGAAGAAGAGC
TTCAACAAGCCGCCAATCAGCCACTTCCAGATGACGATGACGAAGCATTTGAATAGAAGGCATAGCTCAGAGCGGATCAGTTTCACTGTT
GCACCTTTCAATTTCCTTGTCCTTAAACTTTCTATATTCGGACTTCTGTTTTTGTGGTTTGAGGATTTATTTGCTGCTTCCTTGTATTTT
GATTGGTTATTAGATATTTATCTGGGGCCGTGAGGCTGTATTGTATTAGATATCATTAGTTAGTGTTCTATTCCGGTCCTGACGTAAATG
CGTAAATTTCGAGGCTCTGTTTGAGCTTGTTATAATATTTACTAGGTAATATATTCGACAATTTTCTCTGAAAAAAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
RAN1	Ran protein/TC4 protein 1

Genomic locations (0)

None

Library representation (25)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	3
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	3
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	2
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	5
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	1
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	3
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	1
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	5
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	6
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	5
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	3
Solanum lycopersicum	cLEN	fruit pericarp red ripe to over-ripe	3979	7
Solanum lycopersicum	cLER	leaf 4 weeks	5127	1
Solanum lycopersicum	cLES	leaf 4 weeks	5243	1
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	2
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	1
Solanum lycopersicum	cLEY	root pre-anthesis/pre-fruit loading	3259	3
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	3
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	1
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	1
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	2
Solanum lycopersicum	cTOS	suspension cultures	8026	8
Solanum lycopersicum	cTSB	seed	1880	2
Solanum lycopersicum	vSlycmRNA		8362	2
Solanum habrochaites	cLHT	leaf trichomes 4-8 weeks old	2457	2

mRNA member sequences (73)

Alignment image suppressed for unigene with 73 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (4)

Annotations (manual: 2 | blast: 2 | go: 6 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101377	Ras GTPase - Molecular Function: GTP binding (GO:0005525) - Biological Process: small GTPase mediated signal transduction (GO:0007264)	504
2	118418	Ras Ras GTPase - Molecular Function: GTP binding (GO:0005525) - Biological Process: small GTPase mediated signal transduction (GO:0007264)	280
5	129498	GTP-binding nuclear protein Ran - Cellular Component: exosome (RNase complex) (GO:0000178) - Molecular Function: GTP binding (GO:0005525) - Biological Process: intracellular protein transport (GO:0006886) Small GTP-binding protein domain - Molecular Function: GTP binding (GO:0005525) Ras Ras GTPase - Molecular Function: GTP binding (GO:0005525) - Biological Process: small GTPase mediated signal transduction (GO:0007264)	20

Preceding Unigenes (3)

Unigene	Build
SGN-U212975	Lycopersicon Combined #3
SGN-U212976	Lycopersicon Combined #3
SGN-U212977	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer