Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U578139 in the current build, Tomato 200607 #2

Unigene SGN-U312721

Unigene Basic Information

Unigene ID:	SGN-U312721
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	312721
mRNA sequence:	Length: 1215 bp

>SGN-U312721 Tomato 200607 #1 (69 members)
GCACGAGGTGAAACCCTAAAAGCAGAGGAAGCTAAGGGAGAGTAACAGAGCACACCAATGGCGGCAATCACACAGCAACCAAGGACATTG
ACGACGAAAGAGGCTGACATACAGCTGATGTTGGCAGCTGAAGTCCACCTCGGTACTAAGAACTGTGACTTCCAAATGGAACGTTACGTC
TTCAAGCGTCGCAACGACGGTATCTACATTATTAACGCTGGAAAGACATGGGATAAGCTGCATATGGCAGCTAGAGTTATTGTTTCTATT
GAGAATCCTCAGGACATCATTGTGCAATCTGCCAGGCCTTATGGGCAGAGAGCCGTCTTGAAGTTCGCACAATATACTGGTGCACATGCT
ATTGCTGGCCGTCACACCCCTGGTACCTTTACCAATCAGCTTCAGACTTCATACAGCGAGCCAAGACTTCTCATTCTCACTGACCCAAGA
ACTGATCACCAGCCTATTAAGGAAGCTGCTCTTGGAAACATCCCCACTATTGCCTTCTGTGACACTGATTCACCCATGCGATATGTTGAC
ATTGGTATCCCTGCCAACAACAAAGGAAAGCACAGCATTGGTGTTCTCTTTTGGATCTTAGCAAGGATGGTACTACAGATGCGTGGTACC
ATTAGTCCTGGACCCAAGTGGGATGTCATGGTGGATCTCTTCTTTTACAGAGAGCCTGAAGAGGCAAAAGAGCAACAAGATGAGGAAGTA
CCTGCTATTGCTGATTATGCAGAATATGGTGGCGCTGCTCTTGGTGGTGATTGGACTAGCAGCCAAATCCCTGATGCCCAATGGGCTGCA
GATGGTGCAACATCTGTTCCTGCAGCTACTGGTGACTGGTCTGGAGATGCAGTGGTTGAGGGAGGTTGGGATGCTGCAGCTGCTCCTCCT
GCTGGTGTACCAGAAGTGACCCCTGCTCCAGCTGCTGCTACTGGCTGGGAATGAACTTGACTCCTTCAGAGAGTTCTTTTTTGTTAATTT
AGATGTGAGTTCTTGTTACAGACGGTTTTGTTTACAATGCAATTTATAAAAATTTTGGACTTGTTGATGTACGAAAATTATTTAAAATCA
TTTATAGCATGTCTTTTTAGTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
NTTTGGGGGGGGGGGCCCGCCCCCCCCCCCCCCCTAGGGGGGGGT

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (20)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	13
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	2
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	2
Solanum lycopersicum	LA	Leaf Mature leaves	6589	6
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	1
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	2
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	2
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	1
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	2
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	7
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	5
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	2
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	4
Solanum lycopersicum	cLEY	root pre-anthesis/pre-fruit loading	3259	1
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	3
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	2
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	4
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	3
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	6
Solanum lycopersicum	cTSB	seed	1880	1

mRNA member sequences (69)

Alignment image suppressed for unigene with 69 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 1 | blast: 2 | go: 5 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	102508	Ribosomal protein S2 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein S2 eukaryotic and archaeal form - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: small ribosomal subunit (GO:0015935)	13
2	119678	Ribosomal protein S2 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein S2 eukaryotic and archaeal form - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: small ribosomal subunit (GO:0015935)	13
5	130131	Ribosomal protein S2 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein S2 eukaryotic and archaeal form - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: small ribosomal subunit (GO:0015935)	12

Preceding Unigenes (1)

Unigene	Build
SGN-U213066	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer