This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U566122 and SGN-U588894 in the current build, Tomato 200607 #2
Unigene SGN-U312815

Unigene Basic Information 
Unigene ID: SGN-U312815
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 312815
mRNA sequence: Length: 1407 bp

>SGN-U312815 Tomato 200607 #1 (151 members)
GTATTACCTAAAACATTTTTAACAGAAATTGTTAAATATATCTAATCTAAGTAGGTATTACCGAAAAATCTTTTATACAGGGTGACATCA
AACTTTTTAAGAAACATAAACAATTGTGCCAAAATGGCATCTCATCAATTTATTTGTTTCCTAGCAATGATATCTCTTATGATTATCAAT
ATTAGTGCAAACAATGCATGCCACCCTGATGATCTCAAGGGTCTCAATGACTTCAAAGCTGGCATACATTCTGATACTTCAGGCAGACTA
AGCAAATGGATTGGCCAAGATTGTTGCAATTGGCCAGGCATTTCTTGCAACTCTACAACTAATAGAGTTGTACAAATCTATTTACCTGGT
CACTATGTATCTGGTGGCGATGAATCTCCAAACTTCGTATCAAGTACAATGAGTGGTTCAATCTCCCCTTCAATTTCACTTCTCACTTCA
CTACAAGTTATTGATCTTAACAAACTAGTCGGACTAACAGGGCAAATTCCTGAGTCCATTGGGGTTCTCAAGGATCTCAAAGAACTCAAC
TTACAAACCAATCAAATCTCTAGTACAATCCCAGAGTCAGTATTCACATTGACGTCTCTAACAACCTTGAACCTTGAAAACAACCACTTA
ACAGGGGAAATTTCGGAGAATATTTGCAACTTACAAGCACTTCAAAAGCTTTTCTTGTCAAACAATTCATTCACCGGAAAAATTCCACTT
TCAATCACAAAACTACATTCCATTTCCACAATCCACTTAGAAAAAAATCAACTTGTTGGTGAAATGCAATTGCCTTTAACTCCTTCCCAA
TGGCCTTCAATTAAAACTTTGGCTCTTGACAACAATGCACTTACTGGAGTTATACCTGATTCAATTGGTTATTTGACAACACTTTCATCA
CTATCTATGTCAAATAATCAACTAACAGGATCTATTCCTTCTAGTTTGGGAAACATAAAGCAATTGCAAATGTTGAAGGTCAATAACAAC
AATTTATCTGTTGAGATGTTGCCAACGACGATGTGTGGTCTTACTGAGCTAAGTGTATTGTATGTTTCTCAAAACAAGATTCATGGACCA
TTACCTGGATGCCTTTCATCATTCAAGTACTTATTAGATGTCGACGTACCATTCAAACGTACAGCCATTCTTCCTATGGGAGTACAAAAA
CAGTGACGGAGCCAGGAATTATGAAGGAAATCCAAAAATGCCTCAATTTGAAATGTTATGTATGTCTACAATAACCCAAAAAAAAAAACC
TTAGTGTGTTTACTTATTATCTCTATGTTATATGAGACTCCAACTAGCCAGAATCACTGGCTAGTATGAAAAAAATCTAATGCATAAAGT
ACTTCCTTTGTTTTAAAAAAAAAAAAAAAAAAAAAAATAAAAAAAAAAAAAAATAAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
shy leucine rich repeat protein
Genomic locations (0)None
Library representation (5)  
mRNA member sequences (151)  
Alignment image suppressed for unigene with 151 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (1)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (1)