Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U579188 in the current build, Tomato 200607 #2

Unigene SGN-U312845

Unigene Basic Information

Unigene ID:	SGN-U312845
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	312845
mRNA sequence:	Length: 769 bp

>SGN-U312845 Tomato 200607 #1 (16 members)
CAAGTTGAAGAGATACTACTTTCATGTTAAAAGCGTTGACCAGCTCATTTTCACCGTCACTATAATCTCCCCAACGCTTGGTTCCTTTCT
CCTCAAGAACGACAGTATTTCTCTCTGTCTCTGCAACTCCGAATCTAGGGTTTGGGTTAGGGTTTTTTTGGTCAGAGAAAAAAAATGTCT
TCAGGTGCTGGAGCAGGTAAAGGCGGCGCCGGAAGAGGCAAGCCAAAAGCATCGAAATCGGTTTCCCGATCTTCAAAAGCTGGTCTTCAG
TTTCCCGTCGGTAGGATCGCTCGTTTCCTTAAGGCAGGAAAGTACGCTGAACGTGTCGGTGCTGGTGCTCCTGTGTATCTCTCCGCCGTC
CTTGAGTATCTCGCTGCTGAGGTGTTGGAGTTGGCTGGAAATGCTGCTAGAGACAACAAGAAGAATCGAATTGTGCCTAGGCACATTCAA
TTGGCTGTGAGGAATGATGAGGAGTTGAGCAAGCTTTTGGGTCAAGTTACCATTGCTAATGGAGGTGTTTTGCCCAACATTCACCAGAAT
TTGTTGCCTAAGAAGGCTGGCTCTGGGAAAGGTGATATTGGCTCTGCATCTCAGGAGTTTTAGATGTAAATGGGGTGTTATGTTTTGGGA
AGTATTAGGAGAAAGGAGTAGAACTGTTATGTAATATAAAAAAAAATACCCTTTTGTTATTCTGTTATTTAATGGTATGAAATGAAGAAA
AAAGGGCAATAGCCACCTGCAGTTTTGGTTAAAAAAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (9)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	LB	Leaf Mature leaves	3316	1
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	2
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	1
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	3
Solanum lycopersicum	cLER	leaf 4 weeks	5127	1
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	1
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	1
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	5
Solanum lycopersicum	cTSD	seed	1504	1

mRNA member sequences (16)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (2)

Annotations (manual: 1 | blast: 2 | go: 7 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101377	Ras GTPase - Molecular Function: GTP binding (GO:0005525) - Biological Process: small GTPase mediated signal transduction (GO:0007264)	504
2	118521	Histone-fold Histone H2A - Cellular Component: nucleosome (GO:0000786) - Molecular Function: DNA binding (GO:0003677) - Cellular Component: nucleus (GO:0005634) - Biological Process: nucleosome assembly (GO:0006334) - Biological Process: chromosome organization and biogenesis (sensu Eukaryota) (GO:0007001) Histone-fold/TFIID-TAF/NF-Y - Molecular Function: DNA binding (GO:0003677) Histone core - Molecular Function: DNA binding (GO:0003677)	68
5	128935	Small GTP-binding protein domain - Molecular Function: GTP binding (GO:0005525) Ras Ras GTPase - Molecular Function: GTP binding (GO:0005525) - Biological Process: small GTPase mediated signal transduction (GO:0007264) Ras small GTPase Rab type - Molecular Function: GTP binding (GO:0005525) - Biological Process: small GTPase mediated signal transduction (GO:0007264) - Biological Process: protein transport (GO:0015031)	203

Preceding Unigenes (1)

Unigene	Build
SGN-U214233	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer