Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U579445 and SGN-U579684 in the current build, Tomato 200607 #2

Unigene SGN-U312869

Unigene Basic Information

Unigene ID:	SGN-U312869
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	312869
mRNA sequence:	Length: 1238 bp

>SGN-U312869 Tomato 200607 #1 (139 members)
CGGCCGAATTGATCCACAAACTTTGAAATATTAACAATTAAACATGGCTTCTTCTTCTTCTAAATTAGTACTTGTAATGTGTTTTATGAT
TAGTGCTTTTGGCATTGCAATTGGGGCCAAGTTTGATCAAGAATTCGACATTACATGGGGTGATGGCAGAGCAAAAATACTTAACAATGG
CGACCTCCTTACTCTCTCACTTGACAAAATCTCAGGCTCTGGTTTTCAATCCAAGAATGAATATCTGTTTGGTAAAATTGACATGCAGCT
CAAACTTGTCCCAGGAAATTCTGCTGGCACTGTCACTGCTTACTATTTGTCATCACAAGGACCAACACATGATGAGATAGATTTTGAATT
CTTGGGAAATTTAAGTGGTGATCCTTATACTCTCCATACTAATGTATTTAGTCAAGGCAAAGGAAACAGAGAACAACAATTTCATCTCTG
GTTTGACCCTACTGCTGATTTCCACACGTATTCCATCACTTGGAATCCACAACGCATCATATTTTATGTGGACGGAACGCCAATTAGAGA
ATACAAGAATAGTGAATCGATTGGAGTTTCATATCCAAAGAACCAACCCATGAGGATATATTCGAGTCTTTGGAATGCTGATGATTGGGC
TACAAGAGGAGGCCTTGTTAAGACTGATTGGAGCCAAGCACCCTTTAGTGCTTCTTACAGAAACTTCAGTGCTAATGCTTGTATTCCCAC
TTCTTCATCTTCTTGCAGTTCCATTTCTGCAACTTCAACAAGCAATTCATGGTTGAATGAAGAGTTAGATAACACAAGCCAAGAGAGGCT
CAAATGGGTGCAGAAGAATTACATGGTTTATGATTACTGCACTGATTCAAAGCGATTTCCACAGGGATTTCCAGCAGATTGTGTTCAGAA
TATCTGAGCATTAATAATGAAAAAATAGTGTATTACTTTAAAAACTATTGTATTGATTCTTTTATTGTTTTGTACCCATCAGAAGAAGAT
GCAATAATTATTGAGGATTAGAAACATCTTAGTTTTGTACTAAGTTATATAAACAATGAAATAGATACTTTTTTTTCTTCTAAAAAAAAA
AAAAAAAAAAATTTTATCCAAAAGTGAACAGCCCAAAGCCTAAAAAATAAGATGGAAAACAAAAAGAAATCTAGATTTATTCTCTGTATC
TTTTCTTTTGCATTTACAAAAGTATATATCAGGTATTCTTGGTTCTTCCAAAAAAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
xth3	xyloglucan endotransglucosylase-hydrolase 3

Genomic locations (0)

None

Library representation (16)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	3
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	12
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	41
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	54
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	2
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	10
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	1
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	2
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	1
Solanum lycopersicum	cLER	leaf 4 weeks	5127	1
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	2
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	4
Solanum lycopersicum	cLEY	root pre-anthesis/pre-fruit loading	3259	2
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	1
Solanum lycopersicum	cTOS	suspension cultures	8026	1
Solanum lycopersicum	vSlycmRNA		8362	2

mRNA member sequences (139)

Alignment image suppressed for unigene with 139 aligned sequences.
[Show Image]

Markers Information (1)

Expression Data (9)

Annotations (manual: 4 | blast: 2 | go: 6 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101462	Xyloglucan endo-transglycosylase C-terminal - Cellular Component: cell wall (GO:0005618) - Biological Process: glucan metabolism (GO:0006073) - Molecular Function: xyloglucan:xyloglucosyl transferase activity (GO:0016762) - Cellular Component: apoplast (GO:0048046) Concanavalin A-like lectin/glucanase subgroup Glycoside hydrolase family 16 - Molecular Function: hydrolase activity hydrolyzing O-glycosyl compounds (GO:0004553) - Biological Process: carbohydrate metabolism (GO:0005975) Concanavalin A-like lectin/glucanase	129
2	118454	Glycoside hydrolase family 16 - Molecular Function: hydrolase activity hydrolyzing O-glycosyl compounds (GO:0004553) - Biological Process: carbohydrate metabolism (GO:0005975) Xyloglucan endo-transglycosylase C-terminal - Cellular Component: cell wall (GO:0005618) - Biological Process: glucan metabolism (GO:0006073) - Molecular Function: xyloglucan:xyloglucosyl transferase activity (GO:0016762) - Cellular Component: apoplast (GO:0048046) Concanavalin A-like lectin/glucanase subgroup Concanavalin A-like lectin/glucanase	122
5	128954	Glycoside hydrolase family 16 - Molecular Function: hydrolase activity hydrolyzing O-glycosyl compounds (GO:0004553) - Biological Process: carbohydrate metabolism (GO:0005975) Xyloglucan endo-transglycosylase C-terminal - Cellular Component: cell wall (GO:0005618) - Biological Process: glucan metabolism (GO:0006073) - Molecular Function: xyloglucan:xyloglucosyl transferase activity (GO:0016762) - Cellular Component: apoplast (GO:0048046) Concanavalin A-like lectin/glucanase subgroup Concanavalin A-like lectin/glucanase	122

Preceding Unigenes (2)

Unigene	Build
SGN-U213043	Lycopersicon Combined #3
SGN-U213044	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer