Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U579648 in the current build, Tomato 200607 #2

Unigene SGN-U312898

Unigene Basic Information

Unigene ID:	SGN-U312898
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	312898
mRNA sequence:	Length: 674 bp

>SGN-U312898 Tomato 200607 #1 (21 members)
CATTTTTCTCTCATTTTCAACTTCCATGGCGGATCAGCTTACAGATGATCAGATCTCTGAGTTCAAGGAAGCTTTCAGCCTTTTCGACAA
AGATGGAGATGGTTGCATCACCACTAAGGAGCTTGGAACCGTGATGCGTTCGTTGGGACAAAATCCAACTGAGGCTGAGCTTCAAGACAT
GATCAATGAAGTTGATGCTGATGGAAATGGAACCATTGACTTCCCCGAGTTCCTTAACTTGATGGCTCGGAAGATGAAAGACACTGATTC
TGAGGAGGAGCTGAAGGAAGCTTTCCGGGTGTTTGACAAGGATCAGAATGGATTCATTTCTGCAGCTGAGCTACGCCATGTCATGACAAA
CCTAGGCGAGAAGCTTACAGATGAAGAGGTTGACGAGATGATTCGTGAAGCTGACGTGGATGGTGATGGACAGATCAACTATGACGAGTT
CGTCAAGGTCATGATGGCCAAGTGAGAACTGATCAACTCAACTTACCTAAATTCGGTTATTTTGAACCTTATTACAATTGAGGATTTTAT
GTTTTTTATTCTGCGCGACTAATTTTGTTGATATTTCAGATTCTTGTGTATTCGTTCTTGTTATTTTTTACTTAATATACGTTATCGTCT
TCCATTTTTCTCTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (11)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum pennellii	cLPP	pollen pollen collected from open flowers	5426	1
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	3
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	2
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	2
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	1
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	2
Solanum lycopersicum	cLES	leaf 4 weeks	5243	1
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	2
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	2
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	1
Solanum lycopersicum	cTOS	suspension cultures	8026	4

mRNA member sequences (21)

Alignment image suppressed for unigene with 21 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (2)

Annotations (manual: 1 | blast: 2 | go: 1 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101361	Protein kinase - Molecular Function: protein kinase activity (GO:0004672) - Molecular Function: ATP binding (GO:0005524) - Biological Process: protein amino acid phosphorylation (GO:0006468) Protein kinase-like	1515
2	118408	Protein kinase-like Protein kinase - Molecular Function: protein kinase activity (GO:0004672) - Molecular Function: ATP binding (GO:0005524) - Biological Process: protein amino acid phosphorylation (GO:0006468)	587
5	128952	Calcium-binding EF-hand - Molecular Function: calcium ion binding (GO:0005509) EF-Hand type - Molecular Function: calcium ion binding (GO:0005509)	130

Preceding Unigenes (1)

Unigene	Build
SGN-U213181	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer