This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U581016, SGN-U590009, and SGN-U590649 in the current build, Tomato 200607 #2
Unigene SGN-U312944

Unigene Basic Information 
Unigene ID: SGN-U312944
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 312944
mRNA sequence: Length: 1508 bp

>SGN-U312944 Tomato 200607 #1 (512 members)
CCTAACTAGCTATATGTTCTTCCTTTTTTTTTTCAAGTCAAAGTTATACATCATCAAATTCATCTTCTTTTTTCCACAAAAATAAATAAA
TAAAATAATCAAGTTGATCAAGTCACCTGGCGGCTCTTAACAAATTCTAATAATATTCCACTTCAATTAATATCATACACAAGTCTATCT
CAGTGTAGTTATAAATAGCTCTTAATCCATCTTAGTTTGTACCAAAAACATTACTTCTCATCAAACATCATGGCTACCTCACAAATAGCT
ATTATTGTGCTTCTAGGATTACTTGTCGCCACCAACATTCACATAACAGAGGCTCAAATAGGTGTTTGTTATGGAATGATGGGGAACAAC
TTGCCATCACATTCTGAAGTTATACAGCTCTACAAGTCGAGAAACATTAGAAGACTGAGGCTTTATGATCCAAATCATGGAGCTTTGAAT
GCGCTAAGAGGATCAAACATTGAAGTGATATTAGGACTTCCAAATGTAGATGTGAAACACATTTCTTCTGGGATGGAACACGCGAGATGG
TGGGTACAGAAGAACGTTAGAGATTTCTGGCCTCATGTTAAAATTAAGTATATAGCTGTTGGTAATGAAATCAGCCCTGTTACTGGCACT
TCCAATCTTGCCCCATTTCAAGTTCCTGCTTTGGTTAACATTTACAAAGCAATCGGTGAAGCTGGTTTGGGAAATGACATTAAGGTCTCA
ACGTCTGTAGACATGACGTTGATTGGCAATTCTTATCCACCATCACAGGGTTCATTTAGGAACGATGTTAGATGGTTTACTGATCCAATT
GTTGGGTTTTTGAGGGATACACGTGCACCTTTGCTCGTTAACATTTATCCTTATTTTAGCTATTCTGGTAATCCAGGACAGATTTCACTT
CCGTATGCTCTTTTTACAGCACCTAATGTAGTGGTACAAGATGGATCGCGTCAATATAGGAACTTATTTGATGCTATGTTGGATTCTGTT
TATGCTGCGATGGATCGAACAGGAGGAGGATCTGTAGGAATAGTTGTGTCAGAGAGTGGATGGCCATCTGCTGGTGCATTTGGTGCAACA
CATGAAAATGCACAAACATACTTGAGGAACTTAATTCAACATGCTAAAGAAGGTAGTCCGAGAAAGCCTGGACCTATAGAGACTTATATA
TTCGCCATGTTTGATGAGAATAACAAGAATCCAGAGCTTGAGAAGCATTTTGGAATGTTTTCACCAAACAAGCAGCCAAAATACAACCTA
AACTTTGGGGTGTCTGAAAGAGTTTGGGACATTACTAATAGCACTGCTTCTTCACTCACTAGTGAGATTTAAAAAGACATATTTGAAAGC
ATATATATAGTATCTTCATGCAATTTTATGTTTGTATGCAACACCAAATAAATTCGTAGGGGGAACTTTTAAAATTCCTTTTGTTTGTCA
TTCTGGAATGAAACTTTTTGTAAGGTTGTATATTTCAATACACCATCAATTACATTAAAAAAAAAATT


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
TOMB13GLUB beta-1,3-glucanase TOMB13GLUBbeta-1,3-glucanase
Genomic locations (0)None
Library representation (17)  
mRNA member sequences (512)  
Alignment image suppressed for unigene with 512 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (3)  
Annotations (manual: 2 | blast: 2 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (1)