This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U579178, SGN-U581194, and SGN-U590901 in the current build, Tomato 200607 #2
Unigene SGN-U313002

Unigene Basic Information 
Unigene ID: SGN-U313002
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 313002
mRNA sequence: Length: 1044 bp

>SGN-U313002 Tomato 200607 #1 (42 members)
GTAAAAAAATTAAGCTAGTGATCTGATAGCTCATAGGAAAACACTAAAAAAAAATAATAGAATCTTGATCTTACTTACTAGCTATAGTAT
ATGTTTGTTACTATATAAAATAAAAAGCAGAATTGTTTAATCTCTAATTTTGTTAAAACCATAAGTGATAATTTAATTTAATGGATCTTT
CTAACTTAATTGATTTTTTTTTGTCTTTGTGAAAGGTTGAATCTGCACCAGTAGCACCAGTAGAGACTACTCCAGCTGAGGTTGAAGTTA
CCCCAGCTCCAGAGGTAAACAAGGCGGAGGAACCAGCCCCCGCTGTAGAAAAGGATGTTGAGGTCGAATCAGCACCAGCACCAGAAGAGG
CTGCTCCTGCTGCGGAGGAAGTAGCAGCCCCTGTAGCTGAAGAGCCTGCGGCTGCAGAACCTGTAGCCGCAGAATCAGAAGAGCCAGTGG
CAGTTGCAGCAGAACCTGTTGCAGCTCCAGTTGAAGAACCTGTGGCTGCAGAAGAACCTGCAGCCGCAGCTGAGGAACCGGTTGCTGCAG
CACCCGTTGAGGAGGCTCCAGCACCCGTAGCTGAACCCGAAGCAGCCCCAGTTGCAGAACCCGAAGCAGAGAAAACAGAGGAATCTGCCC
CTGCATCTGAGGAGCCAGAGAAAGTTGAAGAGTAAAATTCAAATGGTTGATGAATGATGGTTTTTTTTTTTTTTTATATTGAAATTTGGT
TGTGTTTATTGTGTTTTTTAGTTGAGTATTTTATTTACTGCTACTATTATTATTACTAAAACTATATTTTAATATAATATGGTTACAATG
AGGGCATATGTTAATATTAATATATGCCTAGGTCTAGGTGGTCGGGTGGGATATTTTACATAGTTTTTTTTTAAAGCTATGTGTGTAATC
TTGTCCAGGGTTCAGTTTGTCATGGTTTGATTAAAGATGATATGAGATTTGATCTCTAGTTTATTATAATAATAAAGGGGTAATAACTTT
TTTTTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
ert13 ripening-related mRNA 13
Genomic locations (0)None
Library representation (12)  
mRNA member sequences (42)  
Alignment image suppressed for unigene with 42 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (5)  
Annotations (manual: 0 | blast: 0 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (2)