Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U579178, SGN-U579308, and SGN-U581194 in the current build, Tomato 200607 #2

Unigene SGN-U313012

Unigene Basic Information

Unigene ID:	SGN-U313012
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	313012
mRNA sequence:	Length: 950 bp

>SGN-U313012 Tomato 200607 #1 (374 members)
GGCGATTGGCGGGCGATTGGCGGCCCAATCGGCCGAATTGATCAACAAATTACAATTACAAATATTTTGCCCCCTTCCATTTCTTAATTT
ATTTTCCTCTTTCCCATCTTCTTATTTTCCAACTTTCTTCCAATGGCCAGTGTTGAGGTTGAATCTGCACCAGTAGCACCAGTAGAGACT
ACTCCAGCTGAGGTTGAAGTTACCCCAGCTCCAGAGGTAAACAAGGCGGAGGAACCAGCCCCCGCTGTAGAAAAGGATGTTGAGGTCGAA
TCAGCACCAGCACCAGAAGAGGCTGCTCCTGCTGCGGAGGAAGTAGCAGCCCCTGTAGCTGAAGAGCCTGCGGCTGCAGAACCTGTAGCC
GCAGAATCAGAAGAGCCAGTGGCAGTTGCAGCAGAACCTGTTGCAGCTCCAGTTGAAGAACCTGTGGCTGCAGAAGAACCTGCAGCCGCA
GCTGAGGAACCGGTTGCTGCAGCACCCGTTGAGGAGGCTCCAGCACCCGTAGCTGAACCCGAAGCAGCCCCAGTTGCAGAACCCGAAGCA
GAGAAAACAGAGGAATCTGCCCCTGCATCTGAGGAGCCAGAGAAAGTTGAAGAGTAAAATTCAAATGGTTGATGAATGATGGTTTTTTTT
TTTTTTTATATTGAAATTTGGTTGGGTTTATTGGGTTTTTTAGTTGAGTATTTTATTTACTGCTACTATTATTATTACTAAAACTATTTT
TTAATATAATATGGTTACAATGAGGGCATATGTTAATATTAATATATGCCTAGGTCTAGGGGGCCGGGGGGGATATTTTACATAGTTTTT
TTTTAAAGCTATGGGGGAAATCTTGCCCAGGGTTCAGTTTGTCATGGTTTGATTAAAAATGATATGAAATTTGATCTCTAGTTTATTAAT
AAAAAAAAAAAAAAAAAAAAAAAAATTTTTTTGTTGTTTAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (26)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	6
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	36
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	147
Solanum lycopersicum	LA	Leaf Mature leaves	6589	5
Solanum lycopersicum	LB	Leaf Mature leaves	3316	1
Solanum lycopersicum	LC	Leaf Mature leaves	5712	1
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	8
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	11
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	1
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	23
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	69
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	1
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	1
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	35
Solanum lycopersicum	cLEN	fruit pericarp red ripe to over-ripe	3979	6
Solanum lycopersicum	cLES	leaf 4 weeks	5243	3
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	1
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	1
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	2
Solanum lycopersicum	cTOD	flowers anthesis-stage flowers from full grown plants	5642	1
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	6
Solanum lycopersicum	cTSB	seed	1880	4
Solanum lycopersicum	cTSC	seed	2256	1
Solanum lycopersicum	cTSD	seed	1504	2
Solanum lycopersicum	t3_tus	Rearrayed collection of L. esculentum cDNA clones	1883	1
Solanum habrochaites	cLHT	leaf trichomes 4-8 weeks old	2457	1

mRNA member sequences (374)

Alignment image suppressed for unigene with 374 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (5)

Annotations (manual: 2 | blast: 0 | go: 0 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101424	Cellular retinaldehyde-binding/triple function C-terminal	202
2	119146		20
5	129764		16

Preceding Unigenes (1)

Unigene	Build
SGN-U212704	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer