Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.


This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U580820 in the current build, Tomato 200607 #2
Unigene SGN-U313056

Unigene Basic Information 
Unigene ID: SGN-U313056
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 313056
mRNA sequence: Length: 1052 bp

>SGN-U313056 Tomato 200607 #1 (27 members)
TTTTTTTTTTTTTTTTTTTAAGCAAGAAATTCTTATTTCCACAAAGCCTTTTTCATACAAAGTTTGATATTAGCGACTACAGATATATCA
AAAACATTATTGGCATAGATTCCAGAAGCTCATTGTAGAGCCAGAACACTTGGGAGGCAGTAGTGATAAGCTTAAAGAGCATTGACGATT
TCATCAGCACCGGAGACCGTGAACTCCCCTCCAGATTCAATGTTAGCTACTTTCACCTCAAGGTCATCAACCAAAAGAGCATACCTTCGT
GATCGAACACCAAGCCCCTTATCCGACAGATCAAGCTCCAGCCCAAGGGCATGGGTGTATTTTCCAGCTCCATCAGCAAGAAATTTTACA
TGTTTGTTCTCAGGGTAAGTTTTTGCCCTCGTGCCGAATTCGGCACGGCGTCAGTCTTCTCTGCTATTTCGGTTCCATTCTCCGCCGGCG
ACCATGGTGAACGTTCCTAAAACGAAGAAGACATACTGCAAGTCCAAGGAGTGCAAGAAGCACACCTTGCATAAGGTGACGCAATACAAG
AAGGGAAAAGATAGCTTAGCTGCTCAAGGAAAGCGTCGTTATGATCGCAAGCAGTCAGGTTACGGTGGACAGACAAAACCTGTCTTTCAC
AAAAAGGCAAAGACCACAAAGAAGATTGTCTTGAGGTTGCAATGCCAAAGTTGCAAACATATGTCGCAACACCCAATCAAGAGGTGCAAG
CATTTTGAGATTGGCGGAGACAAGAAAGGAAAAGGAACATCTCTTTTTTAGATTGCTTGTGAAGCAGAATTTGATCTCTCTCTTCTGTTC
TTTCACTGTTTGGATATTTTGTTATATTGAAGGTAGTTCAGTAGCTTCTGTTATCCAATTCATCATTATTACGTGTTCAATCAGATATAT
TATCAGGAGATGAAATGAATATTTCAAGTTTTTGATTTAAAAACAAGTTTTGATTTTGTCTTGTTGATGCAATGATGCTTAAGCTATGGC
AATAAAGTTCAACTGAAAAATGTCCTTGGCTGCATTANNAAAAAAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
tpx1 thioredoxin peroxidase 1thioredoxin peroxidase
Genomic locations (0)None
Library representation (12)  
mRNA member sequences (27)  
Alignment image suppressed for unigene with 27 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (2)  
Annotations (manual: 1 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (2)  
Preceding Unigenes (1)