Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U579086 in the current build, Tomato 200607 #2

Unigene SGN-U313057

Unigene Basic Information

Unigene ID:	SGN-U313057
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	313057
mRNA sequence:	Length: 840 bp

>SGN-U313057 Tomato 200607 #1 (40 members)
CGATTGGCGGCCAATCGGCCGAATTGAACACAAATCTGTCATCACTGTGCAATCTCGTGTCAACCTAAGTAGCAGAAAAATGGCTCCAAT
CGCCGTTGGTGACGTCATCCCCGATGGTACCGTATCTTACTTCGACGAGCAAGATCAGATGCAGACCGTCTCAGTATACTCACTTGCTAA
GGGCAAGAAGGTCATCATCTTCGCCGTTCCCGGAGCTTTCACTCCCACTTGCAGCATGAAGCATGTGCCTGGCTTTATTGAAAAGGCTGC
TGAGTTGAAGTCAAAGGGTGTCGATGAAATCCTCTGCATCAGTGTCAATGACCCCTTTGTGATGAAGGCCTGGGCAAAAACTTACCCTGA
GAACAAACATGTAAAATTTCTTGCTGATGGAGCTGGAAAATACACCCATGCCCTTGGGCTGGAGCTTGATCTGTCGGATAAGGGGCTTGG
TGTTCGATCACGAAGGTATGCTCTTTTGGTTGATGACCTTGAGGTGAAAGTAGCTAACATTGAATCTGGAGGGGAGTTCACGGTCTCCGG
TGCTGATGAAATCGTCAATGCTCTTTAAGCTTATCACTACTGCCTCCCAAGTGTTCTGGCTCTACAATGAGCTTCTAGAATCTATGCCAA
TAATGTTTTTGATATATCTGTAGTCGCTAATATCAAACTTTGTATGAAGAATGCTTTGTGGAAATAAGAATTTCTTGCTTTACTAAAAAA
AAAAAAAAAAAAAAAAAAAAAATATGTAAAATTACTCTGGGGTGAGGTGTGGACAGTAGCGTTGTAACTAAAAAAAAAAATACTGAGATC
TCGCAAATTATTCACTCAATTTGCAACAAA

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
tpx1	thioredoxin peroxidase 1	thioredoxin peroxidase

Genomic locations (0)

None

Library representation (14)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	2
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	2
Solanum lycopersicum	LB	Leaf Mature leaves	3316	2
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	9
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	2
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	7
Solanum lycopersicum	cLER	leaf 4 weeks	5127	2
Solanum lycopersicum	cLES	leaf 4 weeks	5243	3
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	2
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	1
Solanum lycopersicum	cLEY	root pre-anthesis/pre-fruit loading	3259	1
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	1
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	5
Solanum lycopersicum	vSlycmRNA		8362	1

mRNA member sequences (40)

Alignment image suppressed for unigene with 40 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (9)

Annotations (manual: 1 | blast: 2 | go: 0 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101371	F-box associated type 1	575
2	119041	Thioredoxin fold Thioredoxin-like fold	22
5	129663	Thioredoxin fold Thioredoxin-like fold	17

Preceding Unigenes (1)

Unigene	Build
SGN-U214598	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer