Sol Genomics Network

Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U578505, SGN-U579405, SGN-U591971, and SGN-U592210 in the current build, Tomato 200607 #2

Unigene SGN-U313211

Unigene Basic Information

Unigene ID:	SGN-U313211
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	313211
mRNA sequence:	Length: 1055 bp

>SGN-U313211 Tomato 200607 #1 (203 members)
CTTTTACATATCAAACTAGCAACTCCCTCATTTTCCTCTCTTTAAAAACCATGGCAGCTGCTACAATGGCTCTTTCTTCTCCTTCTTTTG
CCGGACAGGCAGTGAAACTCTCACCCTCTGCCTCAGAAATCTCTGGAAATGGAAGGATCACCATGAGAAAGGCTGTTGCCAAGTCTGCCC
CATCTAGCAGTCCATGGTATGGCCCTGACCGTGTTAAGTACTTGGGCCCATTCTCTGGTGAGTCCCCAAGCTACTTGACTGGTGAATTCC
CTGGTGACTACGGCTGGGATACCGCTGGACTCTCAGCAGACCCTGAAACCTTTGCCAAGAACCGTGAACTCGAGGTGATCCACTGCAGAT
GGGCTATGCTTGGTGCTCTTGGATGTGTCTTCCCTGAGCTATTGGCCCGTAACGGTGTCAAGTTCGGTGAGGCTGTGTGGTTCAAGGCCG
GATCCCAGATCTTCAGCGAGGGAGGACTTGACTACTTGGGCAACCCAAGCTTGGTCCATGCACAGAGCATCTTAGCCATCTGGGCTTGCC
AAGTTGTCTTGATGGGAGCCGTTGAAGGTTACCGTATTGCTGGTGGACCTCTTGGTGAGGTTGTCGACCCACTCTACCCCGGTGGCAGCT
TCGACCCATTAGGCCTTGCTGAAGACCCCGAGGCATTTGCTGAGCTCAAGGTAAAGGAGATTAAGAACGGCAGACTTGCTATGTTCTCTA
TGTTCGGATTCTTTGTTCAGGCCATTGTTACCGGAAAGGGTCCATTGGAGAACCTTGCTGACCACCTTGCAGACCCCGTTAACAACAACG
CTTGGGCTTTCGCCACAAACTTTGTCCCCGGAAAATGAATATCATAATATATTTTTTGAATTTTGATTGTTTGATGGCCCTGTAAAGTAG
TTGTGACTTCATAGAATGGATTTTTTTTTCAAAAAAAAAAAAAAAAAAAGTAGTTCTGAGTTACATTTTCCAAAGCTATGAATCAAATAT
TGCCACTTTCATACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (21)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	7
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	1
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	1
Solanum lycopersicum	LA	Leaf Mature leaves	6589	25
Solanum lycopersicum	LB	Leaf Mature leaves	3316	15
Solanum lycopersicum	LC	Leaf Mature leaves	5712	6
Solanum lycopersicum	LE12	Fruit 12 days post anthesis	276	1
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	8
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	4
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	1
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	44
Solanum lycopersicum	cLER	leaf 4 weeks	5127	13
Solanum lycopersicum	cLES	leaf 4 weeks	5243	12
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	17
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	5
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	12
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	2
Solanum lycopersicum	cTOD	flowers anthesis-stage flowers from full grown plants	5642	1
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	1
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	26
Solanum habrochaites	LH_Ea	Glandular Trichomes	3840	1

mRNA member sequences (203)

Alignment image suppressed for unigene with 203 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (6)

Annotations (manual: 3 | blast: 2 | go: 2 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101415	Chlorophyll A-B binding protein - Biological Process: photosynthesis light harvesting (GO:0009765) - Cellular Component: membrane (GO:0016020)	231
2	118429	Chlorophyll A-B binding protein - Biological Process: photosynthesis light harvesting (GO:0009765) - Cellular Component: membrane (GO:0016020)	201
5	128943	Chlorophyll A-B binding protein - Biological Process: photosynthesis light harvesting (GO:0009765) - Cellular Component: membrane (GO:0016020)	163

Preceding Unigenes (4)

Unigene	Build
SGN-U218904	Lycopersicon Combined #3
SGN-U218905	Lycopersicon Combined #3
SGN-U234078	Lycopersicon Combined #3
SGN-U234081	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer