Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U579181, SGN-U579213, and SGN-U581203 in the current build, Tomato 200607 #2

Unigene SGN-U313218

Unigene Basic Information

Unigene ID:	SGN-U313218
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	313218
mRNA sequence:	Length: 1159 bp

>SGN-U313218 Tomato 200607 #1 (291 members)
ATTGATAACAACAACCATCAAAACACAATTCATTTCTTTTTATTTATTAAAATTAAACCATGGCTGCTTCTACAATGGCTCTTTCCTCCT
CTACCTTCGCCGGAAAGACGGTGAAACTCGCACCATCTTCTTCTGAAATCAGTGGAAATGGGAGAATTACAATGAGGAAGACTGCTGCCA
AGCCCAAGCCAGCTTCCTCTGGTAGCCCATGGTATGGTCCTGACCGTGTTAAGTACTTGGGCCCATTCTCTGGTGAATCACCAAGCTATT
TGACTGGTGAGTTCCCTGGTGATTACGGATGGGACACTGCTGGGCTTTCAGCTGACCCTGAAACATTCGCTAAGAATCGTGAGTTGGAGG
TTATTCATTGCAGATGGGCCATGCTTGGTGCTCTTGGATGTGTTTTCCCCGAGCTTTTGGCACGTAACGGTGTTAAGTTTGGTGAAGCTG
TATGGTTCAAAGCTGGATCTCAAATTTTCAGCGAGGGCGGACTTGACTACTTGGGAAACCCTAGTTTGGTTCATGCACAAAGCATTTTGG
CTATTTGGGCTTGCCAAGTTGTGTTGATGGGAGCCGTTGAGGGTTACCGTATTGCTGGTGGGCCTCTTGGTGAGGTTGTTGATCCACTTT
ACCCTGGTGGTAGCTTTGACCCATTGGGCCTTGCTGAAGACCCAGAGGCTTTTGCTGAGCTCAAGGTGAAGGAGATCAAGAACGGCAGAC
TTGCTATGTTCTCCATGTTTGGATTCTTTGTTCAAGCTATTGTCACTGGAAAGGGTCCATTGGAGAATCTTGCCGACCACATTGCTGACC
CAGTTAACAACAACGCCTGGGCCTTTGCCACAAACTTTGTTCCCGGAAAGTGAAGTTTTTGAGAGAAAAAAATGTTACGTCTAGTATCTT
ATTGTTTGATGACAACCATGTAAACCTAGCAATTGTAGATTACTAGAGATTGATTATATATGAAGTTTTTTGCTAAAAAAAAAAAAAAAA
AAAAATTGTTGATTAAATCTAAATCATTAATATTAATATATAGTAACAAGTGGAAAAATGGGACAAGAGAAAATGAAAGATTAATTTCTT
TATGTCATTTATAATGACTTAACAGTTAAATAATGTATCCGTGATAAATTTCGCAATTATATATGGTTATAGTAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (21)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum pennellii	cLPP	pollen pollen collected from open flowers	5426	1
Solanum pennellii	cLPT	leaf trichomes 4-8 weeks old	2729	3
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	16
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	1
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	4
Solanum lycopersicum	LA	Leaf Mature leaves	6589	43
Solanum lycopersicum	LB	Leaf Mature leaves	3316	12
Solanum lycopersicum	LC	Leaf Mature leaves	5712	15
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	2
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	5
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	1
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	35
Solanum lycopersicum	cLER	leaf 4 weeks	5127	29
Solanum lycopersicum	cLES	leaf 4 weeks	5243	16
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	41
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	3
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	12
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	8
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	3
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	40
Solanum lycopersicum	cTSB	seed	1880	1

mRNA member sequences (291)

Alignment image suppressed for unigene with 291 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 1 | blast: 2 | go: 2 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101415	Chlorophyll A-B binding protein - Biological Process: photosynthesis light harvesting (GO:0009765) - Cellular Component: membrane (GO:0016020)	231
2	118429	Chlorophyll A-B binding protein - Biological Process: photosynthesis light harvesting (GO:0009765) - Cellular Component: membrane (GO:0016020)	201
5	128943	Chlorophyll A-B binding protein - Biological Process: photosynthesis light harvesting (GO:0009765) - Cellular Component: membrane (GO:0016020)	163

Preceding Unigenes (1)

Unigene	Build
SGN-U218912	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer