Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.


This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U578058 and SGN-U591314 in the current build, Tomato 200607 #2
Unigene SGN-U313444

Unigene Basic Information 
Unigene ID: SGN-U313444
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 313444
mRNA sequence: Length: 1824 bp

>SGN-U313444 Tomato 200607 #1 (82 members)
TTTATGTGCCTGTAAATTTTTAAATGTGTTCTGAATAAAATCCTTTTTCTCAAGTTCCAATAAATACTTTGCTCTGCTCTTATAATACTC
TCGCTATTCATCACTTCACTTGATAGAAAATATCTATCAAATGGCAATTGTTACAGTAATTGGTGCAACGATTGGCATTTTGATAGCCCT
ATTTTTTGTAAAATCGTTTTATACATTATGGTGGTGGCCAAAGATGATCGAAAAGAAGCTGAAGAAGGAAGGTATTCATGGTCAGCCGTA
CCAATTTCTGTTTGGAAATCTGAAAGAGATGACGAGAATGTCTAGAGAAGCAAAGAAAAAACCATTAGTAAATCACGATATTGTTCCTTG
GGTGAATCCTTTTATTCTTCATCTTTCTAAAACTTACGAGAGATTATTTGTGATGTGGGCTGGACCAACCCCTCGGATTACAGTAACAGA
TCCAAAGCTAATAAAAGAAGTGGTGAACAGACATAATGAATTTCAAAAGCCTCAAGCCAATGCCTTCATTGATATGTTTGTTACTGGACT
TGCTAGTTACAATGGTCAAAAATGGGATCACCATAGAAAGATACTAAACCCGGCTTTTCATATAGAGAAGATTAAGAGGTTGTACCCAGC
ATTTTGCGAGTGTTGTGATGAAATGATAAATAGATGGGAGGACTTGGTTAGCAAAACTGGAAGTTGTGAATTGGATGTAGCAGATGAATT
TCTAAATGTAGGTGGAGATGTTATATCGAGAGCTGCTTTTGGTAGCAATATTGAAGAAGGAAGGACTATTTTCATACTTCAGAAAGAGCA
GTGCGATCTTATTTTGGCTTCTCCATTTACTCTCTTCTTTCCCTTACTAAGATTCTTTCCAACAGAATCAAACAGAAGAGCAAGATACAT
CTACAAAAAAGTGTTATCATTGATCAAAGGAATCATAGAGAAGAAAGAAGACGCTATGCGAAGAGGAGTCTCAGAAAGTGATGATATATT
AGGATTACTCTTAAAAGGAGGACTGTCAACCACTGAAATAATTGAAGAATGTAAGGAATTCTATCTTGCAGGACAAGATACAACCACAGC
TTTGCTCTCCTGGACATTGGTAGCCTTGAGTATGCATCCTGAGTGGCAAGACAAAGCTAGAAATGAAGTATTTCAAGTACTTGGAAAAAA
CAAACCAAAGTTTGAGGACTTGAATCAATTAAAAATAATGAACATGATCTTCCAAGAGGTGTTGAGATTATACCCAGCACTCACCCTTAT
GCGAAGCACCTCAAAGGACACTAAATTGGGAGAAATGACAATTCCTGCAGGAGTACAAATTTTTGTGCCTATATACATAGCACATCGCGA
CCCCCAAGTATGGGGAGACGATGCACTGATTTTCAATCCAAATAGGTTCTCAGAAGGGGTATCCAAAGCTGCAAAAGAGCCATTGTATTT
CCCCTTCGGTTGGGGTCCTCGAATGTGCATTGGTAATAACTTTGGAATGGCAGAAGCAAAGCTCGTTTTATCTCAAATTCTGCAGAGGTT
TTGGTTCAAGCTCTCTCCTTCCTATGTTCATGCCCCTCAGGCAATACTCGTTATGAAGCCTCAGTATGGTGCTCAGATAATCCTCAACAA
GCTCTGATGGTTTACTTAATTATCACAACTACTAGTACTAGTTCAATAAATGAGGTTCATATGTATTCTGCATTTCAATACCATGTTATT
TTTGTATGTGTGACAAACTCTCATTAGCACTATTAAATAATTGTCATCATTAGTTATCGTCTTTTCTTTGGAAAAAAAAAAAAAAAAAAA
AAAAAAAAAACTCGAGGGGGGCCC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
AF249329 cytochrome P450 AF249329cytochrome P450
Genomic locations (0)None
Library representation (21)  
mRNA member sequences (82)  
Alignment image suppressed for unigene with 82 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (2)  
Annotations (manual: 1 | blast: 2 | go: 4 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (2)