Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.


This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U579849 in the current build, Tomato 200607 #2
Unigene SGN-U313868

Unigene Basic Information 
Unigene ID: SGN-U313868
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 313868
mRNA sequence: Length: 2704 bp

>SGN-U313868 Tomato 200607 #1 (13 members)
CTCGTATTTTTCAGTTCTTCTTCCCCATTTCTCTCTGTGCAGATCGCGAACGATTTCGAGAAAATGTCTCACCAGGCTGAGTCATCTGAC
TCAAAAAATTCTAAGAAGGATTTTTCTACGGCGATTTTGGAGCGGAAGAAAGCAGCGAACAGGCTTATTGTAGATGAAACGGTCAACGAT
GATAATTCCGTTGTCGCTTTACATCCTGCTACTATGGAGAAACTTCAGCTTTTCCGTGGAGATACAATTCTGATCAAGGGAAAGAAGAGA
AAGGATACAGTTGTCATTGCCCTTGCTGATGAAACATGTGATGAGCCAAAGATTAGGATGAACAAGGTAGTCCGTTCAAATTTGAGGGTT
CGTCTCGGAGATGTTGTATCTGTGCACCAGTGTCCAGATGTCAAGTATGGGAAGCGTGTCCACATACTCCCTATTGATGATACAATAGAA
GGTCTCACAGGGGATTTGTTTGATGCATTCCTTAAACCTTACTTTTTGGAGGCATATCGTCCATTGAGGAAGGGAGACAATTTTCTTGTT
AGAGGAGGGATGAGAAGTGTGGAATTCAAGGTCATAGAAACTGACCCTGGGGAGTATTGTGTTGTTGCTCCAGACACTGAAATCTTTTGT
GAGGGTGAGCCTGTGAAAAGGGAGGATGAGGAGAGACTTGATGAAGTTGGCTATGATGATGTGGGTGGTGTCAGAAAACAGATGGCCCAG
ATTCGTGAACTGGTGGAACTACCATTGAGGCATCCTCAGCTTTTCAAATCTATTGGTGTGAAACCACCAAAGGGAATTTTACTTTATGGA
CCCCCTGGTTCTGGAAAGACTTTGATAGCCAGAGCTGTTGCTAATGAAACAGGTGCATTTTTCTTTTGCATTAATGGACCTGAAATCATG
TCCAAATTGGCTGGAGAGAGTGAAAGTAATCTTAGAAAGGCATTCGAAGAGGCTGAAAAGAATGCTCCTTCTATCATATTTATTGATGAA
ATTGATTCAATTGCTCCCAAGCGAGAGAAGACACATGGTGAAGTTGAAAGGAGGATTGTCTCACAACTCTTAACTCTGATGGATGGACTG
AAATCTCGTGCTCATGTTATAGTGATGGGAGCGACTAACCGTCCAAACAGCATTGATCCAGCTTTGAGAAGGTTTGGTAGGTTTGATAGA
GAAATAGACATTGGTGTTCCAGATGAAGTTGGGCGTCTTGAAGTTCTTCGCATTCATACTAAGAATATGAAGCTTGCGGAAGAAGTCGAT
TTGGAAAGAATTGGGAAAGATACACATGGTTATGTTGGGGCAGATCTTGCTGCTCTTTGCACTGAAGCTGCTCTTCAGTGCATTAGGGAG
AAGATGGATGTCATTGATCTGGAAGATGACACCATTGATGCTGAGGTGTTGAACTCAATGGCAGTAACAAATGAGCACTTCCAAACTGCT
CTCGGTACAAGCAATCCATCTGCATTGCGTGAAACAGTGGTTGAAGTGCCTAATGTCTCATGGCAAGACATTGGAGGCCTTGAAAATGTT
AAGCGAGAGCTTCAAGAGACTGTTCAATATCCAGTGGAACACCCAGAGAAGTTTGAGAAGTTTGGTATGTCACCTTCGAAAGGTGTACTT
TTCTATGGTCCCCCAGGATGTGGGAAAACCCTACTTGCCAAGGCAATTGCAAATGAATGTCAAGCTAATTTTATCAGTGTCAAAGGACCT
GAACTGCTCACCATGTGGTTTGGAGAGAGTGAGGCGAATGTTCGTGAAATTTTCGATAAAGCCAGACAATCTGCACCTTGCGTCCTCTTC
TTTGATGAGCTTGACTCTATTGCTACTCAGAGGGGCAGCAGCAGTGGAGATGCTGGAGGAGCAGCTGATCGTGTTTTGAATCAACTTCTG
ACTGAAATGGATGGCATGAATGCAAAGAAGACTGTTTTTATAATTGGGGCCACAAACAGGCCTGATATAATTGACCCTGCACTTCTTCGA
CCTGGCCGTCTTGACCAGTTAATTTATATTCCTCTGCCAGATGAAGATTCACGCCATCAGATTTTCAAGGCATGTCTCAGAAAATCCCCC
TTATCAAAGGATATTGATCTGAGAGCTCTCGCCAAACATACTCAAGGATTTAGTGGGGCTGATATCACTGAGATTTGTCAACGATCCTGC
AAATATGCCATAAGGGAGAACATAGAGAAAGATATAGAAAGGGAGAAGAGAAGACAGGAGAATCCCGATTCGATGGATGAGGATGTCGAT
GAAGTACCGGAGATCAAACCCGCTCACTTTGAGGAGTCTATGAAGTATGCCCGTCGGAGTGTCAGCGATGCTGATATACGCAAATACCAG
GCATTTGCTCAGACATTACAGCAGTCTAGAGGTTTTGGAACAGAGTTTCGATTTGCAGAGACTAGTAGCGGCGGGACTGCTGCAGCTGAC
CCATTTGCAACTTCTAATGCCGCAGCCGATGATGATGACCTATATAGCTGAAGTTCTAGTTTTTCCTTGTTATTTTACTGCAAATCTCCT
TCTTCTCGGGTTAAACTCGAATTTCGGAACCTAGTACTCGTTTCTGGATCTCGGGTTTTGACTTTTTAGAACGTTAAGATAATATAAATT
TACTATTATATCCTGGCGGATATTTTTTTGAATTTNAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (7)  
mRNA member sequences (13)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 5 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (1)