This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U585990 and SGN-U585992 in the current build, Tomato 200607 #2
Unigene SGN-U313980

Unigene Basic Information 
Unigene ID: SGN-U313980
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 313980
mRNA sequence: Length: 2536 bp

>SGN-U313980 Tomato 200607 #1 (49 members)
CTCGTGCCGAGAAATTTCTTCATTTTTGACCCCTCCACTCCCAAAAACAACACACAATATTCAAGGATGATAGTTGGCTATAGAAGCACA
ATCATTACCCTTTCTCATCCTAAGCTAGGCAATGGGAAAACAATTTCATCCAATGCAATTTTCCAGAGATCATGTAGAGTAAGATGCAGC
CACAGTACCCCTTCATCAATGAATGGTTTCGAAGATGCAAGGGATAGAATAAGGGAAAGTTTTGGGAAAGTAGAGTTATCTCCTTCTTCC
TATGACACAGCATGGGTAGCTATGGTCCCTTCAAAACATTCACTAAATGAGCCATGTTTTCCACAATGTTTGGATTGGATTATTGAAAAT
CAAAGAGAAGATGGATCTTGGGGACTAAACCCTAGCCATCCATTGCTTCTCAAGGACTCACTTTCTTCCACTCTTGCATGTTTGCTTGCA
CTAACCAAATGGAGAGTTGGAGATGAGCAAATCAAAAGAGGCCTTGGCTTTATTGAAACCCAGAGTTGGGCAATTGATAACAAGGATCAA
ATTTCACCTCTAGGATTTGAAATTATATTTCCCAGTATGATCAAGTCTGCAGAAAAACTAAACTTAAATCTAGCAATTAACAAAAGAGAT
TCAACAATTAAAAGAGCATTACAGAATGAGTTCACGAGGAATATTGAATATATGAGTGAAGGAGTTGGTGAATTATGTGATTGGAAGGAA
ATAATAAAGTTACATCAAAGGCAAAATGGTTCATTATTTGATTCACCAGCCACTACTGCAGCTGCCTTGATTTACCATCAGCATGATAAA
AAATGCTATGAATATCTTAATTCAATCTTGCAACAACACAAAAATTGGGTTCCCACTATGTATCCAACAAAGATACATTCATTGCTTTGC
TTGGTTGATACACTTCAAAATCTTGGAGTACATCGGCATTTTAAATCAGAAATAAAGAAAGCTCTAGATGAAATATACAGGCTATGGCAA
CAAAAGAATGAACAAATTTTCTCAAATGTCACCCATTGTGCTATGGCTTTTCGACTTCTAAGGATGAGCTACTATGATGTCTCCTCAGAT
GAACTAGCAGAATTTGTGGATGAAGAACATTTTTTTGCAACAAGTGGGAAATATACAAGTCATGTTGAAATTCTTGAACTCCACAAAGCA
TCACAATTGGCTATTGATCATGAGAAAGATGACATTTTGGATAAGATTAACAATTGGACAAGAACATTTATGGAGCAAAAACTCTTAAAC
AATGGCTTCATAGATAGGATGTCAAAAAAGGAGGTGGAACTTGCTTTGAGGAAGTTTTATACCATATCTGATCTAGCAGAAAATAGAAGA
TGTATAAAGTCATACGAAGAGAACAATTTTAAAATCTTAAAAGCAGCTTATAGGTCACCTAACATTTACAATAAGGACTTGTTTATATTT
TCAATACGCAACTTTGAATTATGCCAAGCTCAACACCAAGAAGAACTTCAACAATTCAAGAGGTGGTTTGAAGATTATAGATTGGACCAA
CTCGGAATTGCAGAACGATATATACATGATACTTACTTATGTGCTGTTATTGTTGTCCCCGAGCCTGAATTATCCGATGCTCGTCTCTTG
TACGCGAAATACGTCTTGCTCCTGACTATTGTCGATGATCAGTTCGACAGTTTTGCATCTACAGATGAATGTCTCAACATCATTGAATTA
GTAGAAAGGTGGGATGACTATGCAAGTGTAGGTTATAAATCTGAGAAGGTTAAAGTTTTTTTTTCTGTTTTCTACAAATCAATAGAGGAG
CTTGTAACAATTGCTGAAATTAAACAAGGACGATCTGTCAAAAATCACCTTATTAATTTGTGGCTTGAATTGGTGAAGTTGATGTTGATG
GAACGAGTAGAGTGGTTTTCTGGCAAGACAATCCCAAGCATAGAAGAGTATTTGTATGTTACATCTATAACATTTGGTGCAAGATTGATT
CCTCTCACAACACAATATTTTCTTGGAATAAAAATATCCGAAGATATTTTAGAAAGTGATGAAATATATGGTTTATGCAACTGTACCGGT
AGAGTCCTTCGAATCCTTAATGATTTACAAGATTCCAAGAAAGAACAAAAGGAGGACTCAGTAACTATAGTCACATTACTAATGAAAAGT
ATGTCTGAGGAAGAAGCTATAATGAAGATAAAGGAAATCTTGGAAATGAATAGAAGAGAGTTATTGAAAATGGTTTTAGTTCAAAAAAAG
GGAAGCCAATTGCCTCAAATATGCAAAGATATATTTTGGAGGACAAGCAAATGGGCTGATTTCATTTATTTACAAACTGATGGATATAGA
ATTGCAGAGGAAATGAAGAATCACATTGATGAAGTCTTTTACAAACCACTCAATCATTAATCCCTTATTTTGAATTTATGACTTTTGTTC
TTTCCTTCTATATTCCAACTAATAAACTTGTTCGCGCGAATCCAGATAATAAAAAACCTCTATAAACCTGTGGTTTAATCTTTTATCTAA
AAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
SBS Santalene and Bergamotene Synthase
Genomic locations (0)None
Library representation (4)  
mRNA member sequences (49)  
Alignment image suppressed for unigene with 49 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 3 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (1)