This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U581239 in the current build, Tomato 200607 #2
Unigene SGN-U314000

Unigene Basic Information 
Unigene ID: SGN-U314000
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 314000
mRNA sequence: Length: 2707 bp

>SGN-U314000 Tomato 200607 #1 (38 members)
CGAAACGGACCATCCGAAGAAGCTCGTCTGTTTTCTCTATGAGCTAAATTCATCTCTCTCGCGTCATCACTACAAAGATAAAGAAAATTT
TGTTCTATTTCCATTTTCCCAGCTCACCATCTTTGAGTTTGGATTTTCTTCTTTGATTAATGGAGTCCACCGCTTAGACCAGCAGAACCC
GAAATTGGGAAAAAGGGTTAAAGAAGAAGGAGAAAAAGGAGCAGTCTTGGGTACTGTGAGACATAGTTGTTACTGAAGGAACAGTCATGG
CCGTGGATGAGAATGGTTCGTTGAATCGGACGGATGATAGTGTTGTAAAGCATGATTCCGGTGCCGTTGATCATCAGTCGAATCAGAACG
GTGAGACACGGTCAACGATACCTAATGATCAGAATATTCAGATGATGATGTCTGTTAATCATCTACAACAGCAGCAACCCCAGAAAACGA
GTGTGCAGCATAAGGCGCAAATGGGTGTTTTTCAACAGCAGAAGCAAAGCATCAAAGGCAATGGAGTGATGGGTCACCATAATTTTCAAC
ATCAGCATCAGATAATGAACGGTGTTGATTTGAGTAGAAATGGAGGTGTGGGTGATGAGGTTCATGGTGGGGAAGGGTTTAACAGAGAGA
TGAAGGATTTGGAGGAAATGCTTTCCAAATTGAACCCCATGGCTGAAGAGTTTGTGCCTCCCTCACTCTCCACCAACTACGCAGTAGTGC
CAATCTCTCCTGGTGGAGAACAATTTGGGTTTGATCCTTTCAGTTATGCAATGCAAACTGGACAAGGCGATGGAACTTTCAACAGAAGGA
AGAGAAATGGCTATGGTCTTGGTAGGAGAAGGATGAATGTCCGGACAAGCATGGCCCAACGTGAAGAGGTTATTAGGAGGACAGTTTATG
TGTCTGACATTGATCACCAGGTGACTGAAGAGCAACTTGCTACACTCTTTCTTACCTGCGGGCAGGTGGTTGACTGTCGTATCTGTGGAG
ATCCCAATTCTGTACTCCGTTTTGCATTTATTGAGTTTACTGATGAAGAAGGCGCAAGGAGTGCTCTGAGTCTTGCAGGAACTATGCTAG
GATACTACCCTGTGAAAGTGCTTCCCTCTAAAACTGCTATTGCACCAGTTAATCCAACTTTTCTTCCAAGGTCTGAAGATGAAAGGGAGA
TGTGTGCAAGAACTATATACTGTACCAACATTGATAAAAAGGTTACTCAAGCAGATGTCAAGCTCTTTTTTGAGTACTTCTGTGGAGAGG
TTAAGCGCTTGAGGTTGCTTGGTGACTATCATCATTCTACTCGCATAGGTTTTGTTGAGTTTGTTATGGCCGAGAGTGCCATTGCTGCAC
TGAACTGCAGTGGTGCAATCCTGGGATCACTCCCTATAAGAGTAAGCCCATCGAAGACTCCTGTCCGGCCGCGCACTCCCCGCTCGGTGG
TGCAGTAATATATCACTTTGCATTCACCATCTGATCTTATATTTAATATATACGTAGATACAGATACCATCGTGTACCTCATGGCGTTTG
TCTTTTGGTTTATTAGCGTTACTCAACTCGGCATCTCTCACCTTCTTGATACTCTTGTACTGTTGGCTGGTTTGTGAGTTTGCTTATGTT
GATGTAATTTAAGTTTGGTATGGTATTGCTAGCTATTTATGTCTCTGTAGGCAATGCCTCGAGTACCAATACTGCTAACGGTGACTTCTG
AGCAAGTTCCAACTTCAAACTTAAAAAGGAGTGTAATCTCTTCCTTTGTTCTATATGGCTGTTTATTATTCAGCCTATTTAATTTCTTAC
TTGTCTTGATGGTTGTAAATTGTAATTTGCCAGAAAACAAGTCTCATTTTTTTTTTTTGTCAAAGATGCACTACTTGTTTTATATTCATA
TGCGAACATACATTTTACACAAGGTTACAAATGAACCTAGAACAACAAAAGCATGGCGATTCTGAATGTTAGTTAATTTGGACATCAATC
ACCTTTTTCTCCACTTCAGTCTTTGGAATCGAGATGAAAAGAACTCCATTCTTCAGTTCCGCTTTGATTTTATCCTTCACAACATTATCT
GGGAGACTTAAACGAGTGTCGTAAGAGCTATAATTCCTACCCCATGAGTGTTTATCTCTTCCGTCTTCTTCCTTTTTGTGTTCCCCTTTA
ATGACAAGCATGTCATTTTCTACTGATACTTTTACATCTTCCTTGGACAGTCCCGGCATGTCGAAACGCATCTTGATTTCGTTTTCATCA
TCATGAATGTCCCATGGAGTGCGTATTTCCCCTGTTCCTGATGCTCTGTTTCTTCCTGGAAATGTCATTGTATCTTCGAATAATCTGTCC
ATAGTGTCTATCATCTGCCGCATTGTTCTCATCGGTGACATTGGATCTAACACTCCAAAAGGGGAAACATCAAGCGCCATCCTCGTAGGA
CGGCGTTCGACGGCAGTGCCTTGGTTGTTTCCTCCTTGAGCACTGCTGTGGTGTACGTCGACTGACGTATCTTTGTTATCGCCGGTAGCC
CGAGCTACCAGCCTAGTCGTCGGCCTTCTCATCGACGGAACGAAAACAGAGCAAGGTGCAGATACCTTGTTGTTATTAATCTTAGAGGTT
CCACCAACGCTAACATTTGACACTAATGGAGAAGATGTAAGACTTGTGTAAGCCATTATAGTTATTTAGATTTTTAATCACAGAAAGTAG
AAATCTT


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
hsp21 heat shock protein 21heat shock protein
Genomic locations (0)None
Library representation (19)  
mRNA member sequences (38)  
Alignment image suppressed for unigene with 38 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (1)  
Annotations (manual: 5 | blast: 2 | go: 1 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (2)