Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U578250 and SGN-U592686 in the current build, Tomato 200607 #2

Unigene SGN-U314065

Unigene Basic Information

Unigene ID:	SGN-U314065
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	314065
mRNA sequence:	Length: 851 bp

>SGN-U314065 Tomato 200607 #1 (37 members)
CCACCATATAAATAGTCCCTCACGTGCTCTTCGCCTCCCTCGCCACCCATTCTACTTCCTGAATTTTTCTCCTTCTCCTTCTCCGTTCAA
TCGAATTTTTCAGCCATGTCTGACGAGGAGCATCAATTTGAGTCTAAGGCTGATGCCGGAGCATCAAAAACTTACCCTCAACAAGCTGGT
ACTATTCGTAAGAACGGTTATATCGTCATCAAAGGCCGTCCATGCAAGGTTGTGGAAGTCTCTACATCCAAAACTGGCAAGCACGGTCAC
GCCAAATGTCATTTCGTTGCTATTGACATCTTCACTGGGAAGAAGCTTGAGGATATTGTCCCCTCTTCACACAATTGTGATGTGCCCCAT
GTTAATCGTACAGATTATCAGCTTATTGACATCTCTGAAGATGGATTTGTGAGTCTGCTTACTGACAATGGTAACACCAAGGATGACCTC
AGGCTTCCTACTGATGAAAATCTGCTTTCACTGATCAAGGACGGGTTTGCCGAGGGTAAGGACCTCGTTGTGTCTGTTATGTCAGCTATG
GGTGAGGAACAGATTAATGCTTTGAAGGATATTGGCCCCAAGTGATCTCTTGATTGGATGGATTGCTTGACGCGATGGTTCTTTACGACC
TTGAGTGAGATAGATATTTATAGTCATGGAAAAAAATTGTGATCTTATGGAATATTCGTATCATGATTTATGGACCATTGTGAGTTAGAT
TTTTATTTATGTTGTTTTAAATTGTGGTATTCATCTGGAATTTTGTCCTACTAAAGTTTTTTTTATTTGGTGTGGGGGAGATCTTTAACC
TGCAGTTATATACCATCTTCTTCACCTAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
eIF5A3	eukaryotic translation initiation factor 5A-3	translation initiation factor

Genomic locations (0)

None

Library representation (25)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	1
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	3
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	5
Solanum lycopersicum	LB	Leaf Mature leaves	3316	1
Solanum lycopersicum	LC	Leaf Mature leaves	5712	1
Solanum lycopersicum	LE12	Fruit 12 days post anthesis	276	1
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	1
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	1
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	1
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	1
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	1
Solanum lycopersicum	cLEN	fruit pericarp red ripe to over-ripe	3979	1
Solanum lycopersicum	cLER	leaf 4 weeks	5127	1
Solanum lycopersicum	cLES	leaf 4 weeks	5243	2
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	1
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	2
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	2
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	1
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	2
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	2
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	1
Solanum lycopersicum	cTOS	suspension cultures	8026	2
Solanum lycopersicum	vSlycmRNA		8362	1
Solanum habrochaites	LH_Ea	Glandular Trichomes	3840	1
Solanum habrochaites	cLHT	leaf trichomes 4-8 weeks old	2457	1

mRNA member sequences (37)

Alignment image suppressed for unigene with 37 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (1)

Annotations (manual: 1 | blast: 2 | go: 2 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101744	Nucleic acid-binding OB-fold - Molecular Function: nucleic acid binding (GO:0003676) Eukaryotic initiation factor 5A hypusine (eIF-5A) - Molecular Function: translation initiation factor activity (GO:0003743) - Biological Process: translational initiation (GO:0006413) Translation protein SH3-like KOW	41
2	118632	KOW Translation protein SH3-like Eukaryotic initiation factor 5A hypusine (eIF-5A) - Molecular Function: translation initiation factor activity (GO:0003743) - Biological Process: translational initiation (GO:0006413) Nucleic acid-binding OB-fold - Molecular Function: nucleic acid binding (GO:0003676)	41
5	129106	KOW Translation protein SH3-like Eukaryotic initiation factor 5A hypusine (eIF-5A) - Molecular Function: translation initiation factor activity (GO:0003743) - Biological Process: translational initiation (GO:0006413) Nucleic acid-binding OB-fold - Molecular Function: nucleic acid binding (GO:0003676)	40

Preceding Unigenes (1)

Unigene	Build
SGN-U214373	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer