This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U578831 in the current build, Tomato 200607 #2
Unigene SGN-U314421

Unigene Basic Information 
Unigene ID: SGN-U314421
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 314421
mRNA sequence: Length: 2015 bp

>SGN-U314421 Tomato 200607 #1 (412 members)
GGCGATTGGCGGCCAAATCGGCCGAATTGACTTGTGGTTTGTGTTGTTATTCTCTATACGCAGCCAGGGTTTTAGCAAAGCTCAGAAAAG
TTTTAAGACATCATGGGTAAAGAGAAGATTCATATCAGCATTGTTGTCATTGGACATGTCGACTCTGGAAAGTCGACCACTACTGGTCAC
TTGATCTACAAGCTTGGTGGTATTGACAAGCGTGTGATCGAGAGGTTTGAGAAAGAAGCAGCTGAGATGAACAAGAGGTCATTCAAGTAT
GCATGGGTGCTTGACAAGCTTAAGGCTGAGCGTGAACGTGGTATTACCATTGATATTGCCTTGTGGAAGTTTGAGACCACAAAGTACTAC
TGCACTGTGATTGATGCTCCTGGACACAGAGATTTCATCAAGAACATGATTACTGGTACCTCTCAGGCTGACTGTGCTGTCCTCATCATT
GACTCCACAACTGGTGGTTTCGAAGCTGGTATTTCCAAGGATGGACAGACCCGTGAGCACGCATTGCTTGCTTTCACCCTTGGTGTCAAG
CAAATGATTTGCTGCTGTAACAAGATGGATGCTACCACCCCCAAGTACTCCAAGGCTAGGTACGATGAAATTGTCAAGGAAGTTTCTTCC
TACCTCAAGAAAGTAGGATACAACCCTGACAAAATCCCCTTTGTCCCCATCTCTGGTTTTGAAGGAGACAACATGATTGAGCGATCAACC
AACCTTGACTGGTACAAGGGCCCAACCCTACTTGAGGCTCTTGACCAGATTAATGAGCCCAAGAGGCCCTCAGACAAGCCCCTCCGTCTT
CCACTTCAGGATGTCTACAAGATTGGAGGTATTGGAACTGTACCTGTCGGTCGTGTTGAAACTGGTGTGATTAAGCCTGGTATGGTTGTC
ACTTTTGGTCCAACTGGTCTGACCACTGAGGTTAAATCTGTGGAGATGCACCACGAGGCTCTTCAGGAGGCACTTCCTGGTGACAATGTT
GGGTTCAACGTCAAGAACGTTGCAGTTAAGGATCTTAAGAGAGGTTACGTTGCCTCCAACTCCAAAGATGACCCAGCGAAGGGTGCTGCT
AGCTTCACTGCCCAAGTTATCATCATGAACCACCCTGGTCAGATTGGAAACGGATATGCCCCAGTGCTCGACTGCCACACCTCCCACATT
GCTGTCAAGTTTGCTGAGATCTTGACCAAGATTGACAGACGTTCTGGTAAGGAACTTGAGAAGGAGCCCAAGTTTTTGAAGAATGGTGAT
GCCGGTATGGTTAAGATGATTCCCACCAAGCCCATGGTTGTTGAGACCTTTGCTGAGTACCCACCATTGGGACGTTTTGCCGTGAGGGAC
ATGCGTCAGACTGTTGCTGTTGGAGTTGTCAAGAACGTTGACAAGAAAGACCCTACTGGTGCTAAAGTCACCAAGGCTGCCCAAAAGAAG
AAGTGATGTGTTTTTGATGAGATTCTGCATTGATGAACTAGTTTTGTTTAATTGCATTAGCTATTTTCAATTTTGTTTTGAACATTTTAC
CAGTCATAGATATGGCTCCAGAAGCTTTTGTCATGGTTCTCTAGCCTCTTTTGAGGATAGTGGAGTTATTGAGCAATTTGGTTTGATCCA
AGTTGCTTGATGAGCTGTGACAAAAGCATCTCTGATGCCTTTCTACTTTCTGGTTTTTATAGCGAATTCCCAGATAAGATGCTGAGACGG
TTTTAATATGTTATGCTTTTTAAGTTATCTTTTATCTTAAAAAAAAAAAAAAAAAAAAAAAATGGTTTGAGTTGTGTTCATTGCAAGGTG
TTCTTCTCTGTGTCATTGGAGATTTGCCATTGCTGAACTGTTGCTTTGATTGTCTATGCATTTTTCAAATGAGTTTCTTATACGTTTAGA
TTTTGTATTTTTTCTATTCGAGTCTTTCCCCATAGTTGTGGGATCTCTTAAAGACAGGTGACAGTGTCATTTCATTCATGGTCCAGTGTA
AATACCAGCTATACCTAAGATGTAACTTAAGACTT


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (37)  
mRNA member sequences (412)  
Alignment image suppressed for unigene with 412 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 1 | blast: 2 | go: 6 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (1)