This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U577171, SGN-U577865, and SGN-U580403 in the current build, Tomato 200607 #2
Unigene SGN-U314500

Unigene Basic Information 
Unigene ID: SGN-U314500
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 314500
mRNA sequence: Length: 1132 bp

>SGN-U314500 Tomato 200607 #1 (25 members)
TTCACAGTGCAAAAGAAGATGGAAAGCCCTAGAGTTGAGGAGAGTTATGACAAAATGAGTGAATTAAAAGCGTTTGATGATACTAAGGCC
GGTGTTAAAGGACTTGTTGATTCTGGAATTACTAAAGTACCTCAAATATTCGTTCTACCGCCAAAAGACAGGGCTAAAAAATGTGAAACA
CATTTCGTTTTTCCAGTGATAGACCTTCAAGGTATCGATGAGGATCCGATTAAGCATAAGGAGATAGTGGACAAAGTTCGAGATGCATCG
GAGAAATGGGGTTTTTTCCAAGTGGTTAATCATGGGATTCCAACATCCGTCTTGGACAGAACGTTGCAAGGAACACGACAGTTCTTTGAG
CAAGATAACGAGCTGCAAGTTGGAGAGACACGATTTTCTGTTACATGGCTCCGAATCCTCCCAGTCTACAAGAATTTCCAACTCCATGCG
GTTTAAATTTCTAGATCCGCCACTGCTCAGTTGATTGACTATCTAAAGACAGCAAAAATTCCTAGATCTGTCGCTGCTCAGTTGATTGAG
TATCTAAATACAGCAAATTCTTAGATCCGCCATTGCTTAGTTGATTGACTATCTAAAGACGTCTGATTTTATATAAAAATATGTCATGTT
TCAATGCAGGGAGTCATTAATAGACTTCTCCAAGGATGTGAAGAAACTGGGATTCACTTTACTTGAATTATTGTCTGAAGGTCTCGGTCT
CGATCGTAGTTATCTCAAAGATTATATGGATTGTTTTCATCTTTTCTGTTCTTGCAACTACTACCCACCATGTCCTCAGCCAGAACTCAC
CATGGGCACCATTCAACATACCGATATTGGTTTTGTAACGATCCTTCTACAAGATGATATGGGAGGGCTCCAAGTTCTTCACCAGAATCA
TTGGGTTGATGTTCCTCCTACACCCGGTTCTCTAGTGGTGAATATTGGAGATTTTCTGCAGAAAATCTTTTTTTTAATTATTTTTTGCAG
CTCTTGTCAAATGACAAGTACTTAAGTGTCGAGCACAGAGCAATCTCAAACAATGTTGGATCAAGAATGTCAATCACGTGCTTCTTCGGT
GAAAGTCCATATCAATCTTCCAAGCTTTATGGACCGATAACTGAATTGTTAT


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (4)  
mRNA member sequences (25)  
Alignment image suppressed for unigene with 25 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 3 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (3)