This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U580064 and SGN-U581125 in the current build, Tomato 200607 #2
Unigene SGN-U314538

Unigene Basic Information 
Unigene ID: SGN-U314538
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 314538
mRNA sequence: Length: 1946 bp

>SGN-U314538 Tomato 200607 #1 (357 members)
GTGATCAAAAAGTTCCCTGTTTATGGGCGATTGGCGGCCAATCGGCCGAATTGACGAGAATTCTGTGTTAAGAACAAATTTAAAGCTTAT
TGTTTACTCTTTTCTCCTCCAAATTTCTAGGGTTTCTCTCGAAGAATTTTCTGATTTGGGAAGATTGTGATTCGTTTGGGAAAAGTTGGA
TTAGGAACAAACATCAAAAAATTTATATTGTGAATGATCTAATGGAGTCAAAAGGTGGTAAAAAGAAGTCTAGTAGTAGTAGTTCCTTAT
TTTACGAAGCTCCCCTCGGCTACAGCATTGAAGACGTTCGACCAAACGGCGGAGTGAAGAAGTTCAGATCAGCTGCTTACTCCAACTGCG
CGCGCAAACCATCCTGATATTCCCTAAACTTCCTTCCTTAAAGCGTCAATAGACGCAACCAAAAAAAAAAACAAAAAAATAATTTCTGCT
TTCAGTTTCTTCTTTTGTAAAACCCTCACTCCTTTTCTTCCTTCTTTTACTACTTCCTGCTTTTGCACTCATTGCTTTGAACATTTTCCG
CTTTAACTTCCTTTGCTGTTGTGAACTTTTTCATAATGGAAATGGACTTGCCAGTTTCTGCCATTGGTTTTGAAGGTTTCGAAAAGAGGC
TCGAAATTTCTTTCGTCGAGCCTGGTCTGTTTGCTGATCCTAATGGAAAAGGACTTCGATCTCTCACAAAGGCACAGTTGGATGAAATTC
TCGGACCTGCTGAGTGCACCATTGTTGATAACCTGTCAAATGACTATGTTGATTCCTATGTGCTGTCCGAGTCGAGCCTCTTCGTTTATT
CTTACAAGATAATCATCAAAACATGTGGTACCACAAAGCTGCTTCTTGCAATTCCGCCCATTCTGAGGTTGGCTGAGACCTTGTCTCTCA
AAGTACAAGACGTGAGGTATACCCGTGGGAGCTTCATTTTCCCTGGTGCTCAATCGTTTCCTCACCGCCACTTTTCTGAAGAAGTTGCTG
TCCTCGATGGATATTTTGGAAAGCTTGCTGCCGGTAGCAAGGCTGTGATTATGGGAAATCCCGACAAAACACAGAAATGGCATGTCTACT
CTGCCTCAGCTGGGACTGTTCAGTGTAATGACCCTGTTTACACTCTTGAGATGTGTATGACTGGTTTGAACAGGGAGAAGGCATCTGTCT
TCTACAAAACTGAAGAAAGTTCGGCTGCTCACATGACTGTTAGATCTGGCATCAGGAAGATCCTCCCCAAGTCTGAGATATGTGATTTTG
AGTTTGAACCCTGTGGTTATTCTATGAATTCTATTGAAGGAACTGCTGTTTCAACCATTCACATTACCCCGGAGGACGGCTTTAGCTATG
CCAGCTTTGAATCTGTTGGATATGATCCTAAAACCACTGAGTTGGGTCCCCTGGTTGAGAGGGTGCTTGCATGTTTTGAGCCAGCTGAGT
TCTCTATTGCTCTGCATGCTGATGTTGCTACCAAGTTACTGGAGCATGTTTGCTCTGTTGATGTTAAGGGCTACTCTCTTGCTGAGTGGA
GTCCAGAAGAGTTTGGCAAAGGCGGTTCCATTGTCTACCAGAAGTTCACTAGAACTCCTTACTGTGAATCTCCCAAGTCCGTTCTGAAGG
GCTGCTGGAAGGAGGAAGAGAAAGAAGGAAAGGAGTAGTGTTGTCTTGAGGGTCGTATTGTTGTTTTTATTTCAGTGTCTGTTGTTTTCT
CAGAATAATGGACTTATACGTCCAAACTTGTGTCTGTTGGGATTTGCAACGTCTGTGTGCAATTTCTCAACTAGTCTTGCCTTTTGGTGT
TCCACCAGAAGCCTTTTATGTTTCTGCACTTTGAATTGTGTCATGTTGTTGGTTTCTGTTCCTGTTGCGTCTATTTATAAAAGTGTGTTT
GTTTTGTGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACTCGAGACTAGTT


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
samdc S-adenosylmethionine decarboxylaseS-adenosylmethionine decarboxylase
Genomic locations (0)None
Library representation (34)  
mRNA member sequences (357)  
Alignment image suppressed for unigene with 357 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (1)  
Annotations (manual: 1 | blast: 2 | go: 3 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (2)