Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.


This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U578607, SGN-U581328, and SGN-U590986 in the current build, Tomato 200607 #2
Unigene SGN-U314592

Unigene Basic Information 
Unigene ID: SGN-U314592
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 314592
mRNA sequence: Length: 1464 bp

>SGN-U314592 Tomato 200607 #1 (253 members)
TTTTTTTTTTACACTCCAAATTATTATTTGTATAATTTCACTAGAAGGCACCTTATTGGGCGATTGGCGGCCAATCGGCCGAATTGACAT
CAAACATTGATATTCATCTCTTCAATCTTTTGTATTCACATATTCTATTTATTCAATACACTTAGGAAAACACTTTACCAAGAAATTAAG
ATGGAGAACTTCCCAATTATTAACTTGGAAAAGCTCAATGGAGATGAGAGAGCCAACACCATGGAAATGATCAAAGATGCTTGTGAGAAT
TGGGGCTTCTTTGAGTTGGTGAACCATGGAATTCCACATGAAGTAATGGACACAGTAGAGAAAATGACAAAGGGACATTACAAGAAGTGC
ATGGAACAGAGGTTTAAGGAACTAGTGGCAAGTAAGGGACTTGAGGCTGTTCAAGCTGAGGTTACTGATTTAGATTGGGAAAGCACTTTC
TTCTTGCGCCATCTTCCTACTTCTAATATCTCTCAAGTACCCGATCTTGACGAAGAATACAGAGAGGTGATGAGAGATTTTGCTAAAAGA
TTGGAGAAATTGGCTGAGGAGTTACTTGACTTACTCTGTGAAAATCTTGGACTTGAAAAAGGTTACTTGAAAAATGCCTTTTATGGATCA
AAAGGTCCCAACTTTGGTACTAAAGTTAGCAACTATCCACCATGTCCTAAGCCCGATTTGATCAAGGGACTCCGCGCTCATACAGACGCA
GGAGGCATCATACTTCTGTTCCAAGATGACAAAGTGAGTGGCCTTCAACTCCTCAAAGACGAGCAATGGATCGATGTTCCTCCCATGCGC
CACTCTATTGTGGTTAACCTTGGTGACCAACTTGAGGTGATCACTAACGGGAAGTACAAGAGTGTGCTGCACAGAGTAATTGCACAAACA
GACGGGACACGAATGTCATTAGCCTCATTTTACAATCCAGGAAGTGATGCAGTAATATATCCAGCAAAAACTTTGGTTGAAAAAGAGGCA
GAGGAAAGTACACAAGTGTATCCAAAGTTTGTGTTTGATGATTACATGAAGTTATATGCTGGACTCAAGTTTCAAGCCAAAGAGCCAAGA
TTTGAAGCAATGAAGGCAATGGAAAGTGATCCAATTGCAAGTGCTTAGATCCCAATTCAATTAAAAAAATTGGTGTTTGAAAAATATATT
TAAATATAGCAATCTATGTATACACATTATTTGCTCTTCTTATGTATGGTAGAATAAAGTTAGTATTAAAAAAGATTGTGATTTGCTGCA
TATGTATCAAAAAGAGTCCTAATATTTGTATCTATAAATAAGGTGCCTTCTAGTGAAATTATACAAATAATAATTTGGAGTGAAAAAAAA
AAAAAAAAAAATTGTTCTTTCTCATGTAATTTAACTTTTAAGTATCTTACTTTACAATATACTGTTCACTTATTGAACATATTGAGTGAA
AAAAAAAAAAAAAAAAACTCGAGA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
efe ethylene-forming enzymeethylene-forming enzyme
Genomic locations (0)None
Library representation (19)  
mRNA member sequences (253)  
Alignment image suppressed for unigene with 253 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (11)  
Annotations (manual: 4 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (1)