Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U578177 in the current build, Tomato 200607 #2

Unigene SGN-U314653

Unigene Basic Information

Unigene ID:	SGN-U314653
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	314653
mRNA sequence:	Length: 637 bp

>SGN-U314653 Tomato 200607 #1 (60 members)
GGGCGATTGGCGGCCAATCGGCCGAATTGAACGCCACTTCACAAAAAAAAGCTTATTTGGGTTAGGAGAGAGAGTTTTCATCAACAGATC
CAAACTCTTAACCCTAAAAATCAACCATGTCTTCCAAGCAAGGTGGAAAAGCAAAGCCTTTGAAGGCACCAAAGACTGAAAAGAAGGAGT
ATGATGAGAATGACAAGGCTTTTCTTGCAAAGAAGAAGGAAGAAGAAAAGGCCCTGAAGGAGCTCAAGGCAAAGGCTCAGAAAGGGTCCA
TTGGCGGTACTGGCTTGAAAAAGAGCGGAAAGAAGTGAGGATGTGATATTCTTCCTCCTAGTATTAAAAAGCCCTTATCCATGGCTTGGT
TTGGTGTTGTTCTAAGTTCAAATAGTGTTACGTTTTTGTTAACTTTTGGGATGTTTCTCTGTTGACTGAATGAATTAGGACCGGGGCACT
TGCTCCTTTCCAATATATACTGACCTGTATTGTGGTGCCTTTGACTATCAATAATTCTATATTGGCGTTAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATGGGGGGGGGGGGGGGGAACCATTTTCCCCTTAAAAGGGGAAA
AAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (17)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum pennellii	cLPP	pollen pollen collected from open flowers	5426	4
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	15
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	7
Solanum lycopersicum	LB	Leaf Mature leaves	3316	1
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	2
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	1
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	1
Solanum lycopersicum	cLER	leaf 4 weeks	5127	1
Solanum lycopersicum	cLES	leaf 4 weeks	5243	2
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	6
Solanum lycopersicum	cLEY	root pre-anthesis/pre-fruit loading	3259	1
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	4
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	2
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	3
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	4
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	4
Solanum lycopersicum	cTOS	suspension cultures	8026	2

mRNA member sequences (60)

Alignment image suppressed for unigene with 60 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (2)

Annotations (manual: 0 | blast: 0 | go: 0 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	# Members
1.1	102645	11
2	119918	11
5	130225	11

Preceding Unigenes (2)

Unigene	Build
SGN-U212997	Lycopersicon Combined #3
SGN-U232259	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer