Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U577544 and SGN-U579804 in the current build, Tomato 200607 #2

Unigene SGN-U314657

Unigene Basic Information

Unigene ID:	SGN-U314657
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	314657
mRNA sequence:	Length: 1022 bp

>SGN-U314657 Tomato 200607 #1 (29 members)
GCACGAGCTTAGATCTCACCGCCGTTTACACACTTGGTGAACCTCTCTCCTTTCATTTGGTGAAGGGTGAACAGGTTTCAACAGTTGCCA
TGGCTCTGATTTTGCACTCAACAAATAACAACAAAAATGCCTCAAAGGCACTCATTGCGGCTGAGTACACAGGTGTAAAGGTTGAAGTTC
CAAAGGATTTCCAGATGGGTGTGTCAAACAACACACCTGAGTTTCTTAAGATGAACCCGATTGGAAAGGTTCCTGTGCTTGAAACACCTG
ATGGACCTGTTTTTGAGAGCAATGCTATCGCACGCTATGTTACTAAATTAAAGCCCAACAATCCTCTTTTTGGATCTTCATTGATTGAAT
ATTCTCAAATTGAACAATGGAATGATTTTTCTGCCACTGAAGTTGATGCAAACATTGGACGATGGCTGTACCCACGCCTTGGCTTTCGTG
TGTACATCCCTGCGGCCGAGGAAGCTGCGGTAGCTGCATTGAAGAGAGCGCTTGGTGCTTTGAACACCCATCTTGCATCTAACACATACT
TGGTTGGGCATTCAATCACATTGGCTGACATCATTATGGTCTGCAACTTGAGCATTGGTTTTAGGATGATAATGACCAAGAGCTTTACCA
AGGAATTCCCACATGTAGAGAGATACTTCTGGACTGTGGTTAATCAGCCAAACTTCTGCAAGATATTGCGTGAAGTGAAGCAAGCTGAAT
CTATCCCAGCTGTGCAATCCAAGAAGCCTGCACAACCTGAAAAACCCAAGGCTAAGGAGGAGCTAAAGAAGGAGGTTAAGAAGGAAGAAC
CAAGTCCTGTAGAGGAGGAAGCAGCACCCAAACCTAAGGCAAAGAATCCTCTTGATCTCTTGCCTCCAAGTAAGATGATTCTGGATGACT
GGAAGAGGCTTTACTCTAACACCAAGACCAACTTCCGTGAGGTTGCCGTTAAAGGTTTCTGGGACATGTATGACCCCGAAGGATATTCTC
TCTGGTTTTTGTGATTACAAGTACAATGATGA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (15)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	2
Solanum lycopersicum	LA	Leaf Mature leaves	6589	3
Solanum lycopersicum	LC	Leaf Mature leaves	5712	1
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	2
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	1
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	2
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	3
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	1
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	1
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	1
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	1
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	2
Solanum lycopersicum	cLEY	root pre-anthesis/pre-fruit loading	3259	1
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	4
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	4

mRNA member sequences (29)

Alignment image suppressed for unigene with 29 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (1)

Annotations (manual: 0 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101396	Thioredoxin-like fold Glutathione S-transferase C-terminal-like	299
2	119155	Elongation factor 1 gamma chain - Molecular Function: translation elongation factor activity (GO:0003746) - Cellular Component: eukaryotic translation elongation factor 1 complex (GO:0005853) - Biological Process: translational elongation (GO:0006414) Thioredoxin fold Glutathione S-transferase C-terminal Glutathione S-transferase C-terminal-like Glutathione S-transferase N-terminal Thioredoxin-like fold	19
5	129505	Elongation factor 1 gamma chain - Molecular Function: translation elongation factor activity (GO:0003746) - Cellular Component: eukaryotic translation elongation factor 1 complex (GO:0005853) - Biological Process: translational elongation (GO:0006414) Thioredoxin fold Glutathione S-transferase C-terminal Glutathione S-transferase C-terminal-like Glutathione S-transferase N-terminal Thioredoxin-like fold	19

Preceding Unigenes (2)

Unigene	Build
SGN-U212996	Lycopersicon Combined #3
SGN-U212998	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer