This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U577731, SGN-U578517, and SGN-U578557 in the current build, Tomato 200607 #2
Unigene SGN-U314699

Unigene Basic Information 
Unigene ID: SGN-U314699
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 314699
mRNA sequence: Length: 1504 bp

>SGN-U314699 Tomato 200607 #1 (35 members)
GAGGCTATACGGTCTCATAAGCCGGTGAACCGACTAGTGTAAGCGGAGCATTTCAGTTGCTGCCAATCGCCTTGTGGTTTTTTCGCATCT
GGACTCCAATGGCCGCTATATTAGCTCGCAAGTCTCTATCTGCTCTTCGTTCTCGTCAGCTTGTTTTAGCAGGACAAGCATGGCAAGGGA
CTAATACACCTAATGGAACTCTGCTTGGTACTCGATCATTTGCTACCAAACATTCATTTTCAACTGACAAAGATGATGAGGAAAGAGAGC
AGCTAGCAAAGGAGCTATCAAAAGATTGGAATTCAGTCTTTGAGCGAAGCATAAATACTCTCTTTTTGACTGAAATGGTTCGAGGTCTGA
TGCTGACGCTCAAGTACTTCTTTGAAAAGAAAGTGACTATTAACTATCCATTTGAAAAGGGTCCTTTAAGCCCTCGTTTTCGTGGAGAAC
ATGCCCTTCGACGTTATGCCACAGGAGAGGAAAGATGCATTGCATGTAAACTTTGTGAAGCTATTTGCCCTGCTCAAGCTATCACAATCG
AGGCTGAGGAGCGAGAAGATGGCAGTCGTCGAACAACTAGGTATGATATCGATATGACAAAGTGCATCTACTGTGGATTCTGCCAAGAAG
CCTGCCCTGTTGATGCCATTGTTGAGGGGCCCAACTTTGAGTTTGCAACTGAAACTCATGAGGAACTTCTTTATGACAAGGAGAAGCTTC
TTGAGAATGGAGATAGATGGGAAACTGAGATTGCAGAGAATCTGAGATCTGAAAGCCTCTATCGCTGAGTTCGTTCTTTGAATATAAGCG
GGTCTTTATTATAAAATAATCCACAAAATAAAGAGACGTGGTGAATGCTCTTATTTGCATTTTCCCTTGTTTTTTGATTGATGAGATGGC
TCTATTTCGTACAGATCTGTGAATGAAATAGAGCAGAATCTTGAACTAGATTTCTGGTACAGCAAGCTGACTTATCTGTAATGTAACCAT
GGTCATAGACTCTAGTGGCTATGTCACTGCAATTACTCCTTTCGTGCCAATGGTGTCTTTATGGAAAAGTTATATGGAACCATGATAACC
CAATTTGGATCTGGATGATCCATTGCTAGTTGTAGAAGAGATTGAATTTTGTTCATTTTCTTGTGCTCTGCCATTTATTATTGCCAAAAG
TCGAACACCAAAGAGGCACTGACTTGGAAGAAGCAATATGGCTTCCTCTGTCATTTCTTCAGCAGCTGTTGCCACACGCAGCAATGTTAC
ACAAGCTAGCATGGTTGCACCTTTCACTGGTCTCAAATCTTCAGCCACTTTCCCTGTTACAAAGAAGCAAAACCTTGACATCACTTCCAT
TGCTAGCAATGGTGGAAGAGTTAGCTGCATGCAGGTGTGGCCACCAATTAACATGAAGAAGTACGAGACACTCTCATACCTTCCTGATTT
GTCTGACGAGCAATTGCTTAGTGAAATTGAGTACCTTTTGAAAAATGGATGGGTTCCTTGCTTG


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
ss5 Tomato RuBP carboxylase small subunit
Genomic locations (0)None
Library representation (20)  
mRNA member sequences (35)  
Alignment image suppressed for unigene with 35 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (2)  
Annotations (manual: 1 | blast: 2 | go: 8 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (1)