This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U578246 and SGN-U591949 in the current build, Tomato 200607 #2
Unigene SGN-U314704

Unigene Basic Information 
Unigene ID: SGN-U314704
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 314704
mRNA sequence: Length: 952 bp

>SGN-U314704 Tomato 200607 #1 (221 members)
TTTTTTTAGTAAAGAAACAAATATCATTAATATAGTTCTTGTAAACTTGATTGAAATTCGAATTAATCATACACGGAATAAAGTTTCTTT
GAAATTAAAAAAAAAAAAAACATTTTATAGCTAAGTAAGTAAACGCAATGGCTTCCTCAATTGTCTCATCGGCAGCCGCTGCTACCCGTA
GCAATGTTGCTCAAGCTAGCATGGTCGCACCCTTCACCGGACTCAAATCCGCCGCTTCTTTTCCCGTTACCAAGAAGAACAACAACGTTG
ACATTACCTCCCTTGCTAGCAATGGTGGACGCGTTAGATGCATGCAGGTGTGGCCACCAATCAACATGAAGAAATACGAGACATTGTCAT
ACCTTCCTGACTTGTCCGATGAGCAATTGCTTAGCGAAATTGAGTATCTTTTGAAAAATGGATGGGTTCCTTGCTTGGAATTCGAGACTG
AGCGCGGATTTGTGTACCGAGAGAACAACAGTTCCCCTGGATACTACGATGGTAGATACTGGACCATGTGGAAGTTACCTATGTTTGGGT
GCACTGATGCAACACAGGTGTTGGCTGAGGTTCAAGAGGCGAAGAAGGCGTACCCACAAGCCTGGGTTCGTATTATCGGATTCGACAACG
TTCGTCAAGTCCAGTGCATCAGCTTCATTGCCTACAAGCCAGAAGGATTCTAAATTTCCAAACATATAATCAAAATGTTTGTTTGATTTG
TACCTAAGTCTTTAATTTTTTTTCTTCAATTTTTGTTTTGCATTTTGTTCCTATTTGTACCGGTGTATTTTCTTCGATTCCGACCAAGTT
ATGAGAAATTAATAATGATGAATCGGTGGTTATATGTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAANNNCCCGGGGGGGGGGGGCCCCCCCCCTTTCCCCCCTTGGGGGG


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
TOMRBCSD RuBP carboxylase small subunit
Genomic locations (0)None
Library representation (16)  
mRNA member sequences (221)  
Alignment image suppressed for unigene with 221 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (7)  
Annotations (manual: 1 | blast: 2 | go: 3 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (2)