Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U578731 in the current build, Tomato 200607 #2

Unigene SGN-U314717

Unigene Basic Information

Unigene ID:	SGN-U314717
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	314717
mRNA sequence:	Length: 637 bp

>SGN-U314717 Tomato 200607 #1 (34 members)
AAACAAACGCGTCAAAATACTTCTCATCCATTTTCCTTCCAGATCGGAGAATCCATTTTCCCTAATTCTCAGCATTCTTAAGTGACTAGA
AATGGCATTGGGTGGAGGTGGACCACAAAGAGGGACTGCAGCAGCAGCAGCTGCTAACCTACGTCGAAGGAAGACAGGAGGAGCAGGTGG
AGCTGCAGGAGGAGCAGGTGGTACCATGCTTCAATTCTACACTGATGATTCCCCCGGACTCAAGATATCCCCCAATGTTGTGCTTGTGAT
GAGTATTGGCTTCATAGCCTTTGTTGCGATCCTTCACGTCATGGGTAAGCTCTACTTTGTCCGCAGGGAGGGCTAGTGACCGAACCGTTG
CTGAGTTGGGAAATTTTTGTTGGACAACATCTTTCATCGTTTAAGGAAAAACTGACATTGTAGCTTTATTTTCTTGTTTGTTTGTCTAAT
GCTATGGAGTCTATAGAAAAGTTTTCTAGTTATGAGTCGATTTTTTCTTGTGCTATTCCAACACTTTCTAATGAACAAGAAGGTGCCAAA
TTCTAGTTTCTTAGACCGTGAAAAAAAAAAAAAAATAGCTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
GAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (15)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	1
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	2
Solanum lycopersicum	LB	Leaf Mature leaves	3316	1
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	3
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	2
Solanum lycopersicum	cLES	leaf 4 weeks	5243	2
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	3
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	1
Solanum lycopersicum	cLEY	root pre-anthesis/pre-fruit loading	3259	1
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	1
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	1
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	3
Solanum lycopersicum	cTOS	suspension cultures	8026	6
Solanum lycopersicum	cTSB	seed	1880	5
Solanum lycopersicum	cTSC	seed	2256	2

mRNA member sequences (34)

Alignment image suppressed for unigene with 34 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 1 | blast: 2 | go: 0 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101375	Chaperonin Cpn10 - Molecular Function: ATP binding (GO:0005524) - Biological Process: protein folding (GO:0006457) GroES-like	508
2	124176		4
5	133109		5

Preceding Unigenes (1)

Unigene	Build
SGN-U214519	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer