This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U570163 in the current build, Tomato 200607 #2
Unigene SGN-U315169

Unigene Basic Information 
Unigene ID: SGN-U315169
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 315169
mRNA sequence: Length: 1520 bp

>SGN-U315169 Tomato 200607 #1 (26 members)
GCAGATTCACTTTACTCTTCATTTGTGTTCTCAAAACAGAGCGGGAAGACACAGAGAGAGCGAGATAGATTCAATTCACTGTTAACACTT
TTGTTCAATCAGTCGACGCTGCATTTTGGGCAAATTATTGCATTCATAAACGAAGAAATTTGTTAATTTGCAACAAAGAAGGCGGCAGGG
CATCAAAGGGCGATGGATTTGGATCAGTGGATTACGACGGTGAAAGAGGGGCAGCATTTGGCGGAGGACGAGCTTCAGCTCCTTTGTGAA
TATGTTAAGGAAATCCTGATAGAGGAGTCAAATGTGCAGCCCGTCAATAGTCCAGTTACTGTTTGTGGAGACATCCATGGCCAGTTTCAT
GATCTAATGAAACTCTTCCAGACTGGAGGTCATGTACCTGATACAAATTACATTTTCATGGGAGATTTTGTTGACCGTGGATACAATAGT
TTAGAAGTTTTTACAATTTTGTTGCTCCTTAAAGCAAGATACCCAGCCAACATTACTCTTTTACGTGGAAATCACGAGAGCAGGCAACTA
ACACAGGTCTATGGATTCTATGATGAGTGTCAAAGGAAGTATGGAAATGCGAATGCATGGCGGTACTGCACTGATGTTTTTGACTATCTT
ACTCTCTCGGCAATCATAGACGGAACAGTATTATGTGTCCATGGTGGACTTTCTCCTGATGTTAGAACAATTGATCAGATCAGAGTGATT
GACCGTAATTGTGAAATTCCGCATGAAGGGCCTTTCTGTGACCTTATGTGGAGTGACCCCGAAGATATTGAAACATGGGCAGTAAGTCCT
CGAGGAGCAGGTTGGCTTTTTGGATCCAGGGTTACCTCTGAGTTTAATCACATTAATAAACTAGATCTAGTTTGCCGGGCTCACCAGCTT
GTCCAGGAAGGTTTGAAATACATGTTTCAAGATAAAGGATTGGTGACGGTGTGGTCTGCTCCCAACTATTGTTACCGATGTGGAAATGTT
GCTTCAATATTGAACTTCAATGAGAATATGGAGAGAGAGGTAAAGTTCTTCTCTGAAACTGAGGAAAACAACCAGATGAGAGGGCCCAGG
ACAGGAGTTCCTTATTTCTTATGAGGAATGCTCGGCCTTTTCTTCTTCTGATATTATTTCTGCATTTCATCCGGCCACCCCCTTATTAAT
GGGAAAATTTAAGGGAGAGTGTCTGTCCGGAGGGGACTGAATAGATGGTGGTATATGCCTTAGCTTGTCTGGTTGACCCCACTGGCTCCG
AATAGTTTGTGCTATGTATTTACAATGGCCTCGAATGCTGCTCCCCATCTGTTCCGTAATTATTTTTGAATGTGTCATATTGGTGATATT
GTACCTTGACCAGATTACAGTTTTTTAGATTTTACTCGTTTGCATTTTTGCTAGATGTACATTTTATTTTTGCTTTGAATTTGAAAACTA
TTGTTCATTTTACAATTCAAAATCGGATAAAAGCTTGAATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (8)  
mRNA member sequences (26)  
Alignment image suppressed for unigene with 26 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (14)  
Annotations (manual: 3 | blast: 2 | go: 1 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (1)