Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.


This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U585215 and SGN-U585217 in the current build, Tomato 200607 #2
Unigene SGN-U315407

Unigene Basic Information 
Unigene ID: SGN-U315407
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 315407
mRNA sequence: Length: 1637 bp

>SGN-U315407 Tomato 200607 #1 (32 members)
CAACACCAAAACTTGTTAAGAAAAATGTCTTCTTATTCAGAGCTATCAAATCTTCCGATTCGTGAAATTCCAGGGGACTATGGTTTCCCT
ATAATTAGCGCGATTAAAGATCGATACGATTATTTCTATAACCAAGGTGAAGATGCTTGGTTCCATAACAAAGCTGAAAAATACAAATCT
ACTGTTGTCAAAATCAACATGGCACCAGGTCCATTCACATCTAATGACTACAAATTGGTAGCCTTTTTAGATGCCAATAGCTTTGTTTGC
ATGTTTGATAATTCCCTCATTGATAAAACTGACACTCTTGGTGGTACATTTAAGCCTGGTAAAGAATACTACGGTGGTTATCGTCCCGTC
GCGTTTATCGATACCAAAGATCCAAACCACGCAGCATTAAAAGGCTACATTTTATCATCATTCGCAAAGCGACATAACTTATTCATTCCT
CTGTTCAGAAACACGTTATCCGATCATCTTTTTAATAATCTCGAAAAACAGGTTACTGAACAGGGGAAAGCAGATTTCAATGCTTTGCTT
CCGACTATGACGTTTGATTTCATTTTTCGTTTGCTTTGTGATCAGAAAAATCCGTCTGATACAGTTCTTGGCGCTCAAGGACCAGAACAT
CTACGTAAATGGCTTTTCCCACAGCTAATTCCGTCCTTGAGCGCCAAGAAACTTCCTAACATCATAGAAGATATGCTCTTCCATAATTTT
TTAATACCATTTGGTTTTATAAAGAGTGATTACAACAAACTTGTTGATGCATTTAGCAAGTCTGCTGTGTCCATGTTGGATGAAGCAGAA
AAACTTGGAATCAAAAGAGAAGAAGCTGTACAAAACATTCTTTTTCTCGTGGGGATCAATATGTTTGCGGGGCTGAACGCCTTTTTCCCT
CATCTATTCAGGTTTGTGGGCGAAGCAGGGGCTAGTCTACACACACAACTTGCTAAAGAAATCAGGAGTGTTATTAAAGAAGAAGGTGGT
GCAATCACATTATCAGCGATTAACAAAATGAGTTTGGTCAAATCGGTAGTGTACGAGACATTGAGACTTCGCCCACCAGTACCATTACAG
TATGGTAAGGCGAAGAAAGAGTTCATGGTTCAAAGCCACGATGCATCTTACAAGATCAATAAAGGACAATTCGTAGTTGGATATCAGCCC
ATGGCTAGTAGGGACCCTAAGATTTTCGCAAACCCGGATGAGTTTGTACCTGATAGGTTCATGAATGATGGTGAGAAAATGCTGAAACAT
GTCCTATGGTCTAATGGAAGGGAAACAGAGAGTCCAGCACCAGATAACAAGCAATGTCCAGGCAAAGATTTGGTGCACCTATTGGGTAGG
TTAATATTGGTTGAATTTTTCATCAGATACGATACATTCACCCTGGAAATTACACCTCTATTTCGTGCACCAAATGTTGCGTTCAACACA
TTAACTAAAGCAAGTAAATAGTTTGTTATGTGATCAAACTGTGTGTGCCCGCTCACGTTGCATATTCTCTTATTGATTATTTTATTTTTT
TGGTTGTATTTATTTAGTTTTTGTTGTAAATCTTCTTTATGATTCAAATGAATAAACGTTGATTCTAGATCGGATCAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
des divinyl ether synthase
Genomic locations (0)None
Library representation (8)  
mRNA member sequences (32)  
Alignment image suppressed for unigene with 32 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (2)  
Annotations (manual: 1 | blast: 2 | go: 5 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (1)