Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U581128, SGN-U590769, and SGN-U593769 in the current build, Tomato 200607 #2

Unigene SGN-U315443

Unigene Basic Information

Unigene ID:	SGN-U315443
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	315443
mRNA sequence:	Length: 813 bp

>SGN-U315443 Tomato 200607 #1 (26 members)
GGCGATTGGCGGCCAATCGGCCGAATTGATCTTCTCTTCGATAATCAATTATCTGAAAAAAAAGAAGCTATTCTTTGAAATGGAGTCTAC
CGGAAAAGTGAAGAAGGGTGCCGCCGGCAGAAGGGGAGGAGGCCCAAAGAAGAAGCCTGTTTCCCGGTCTGTTAAGGCCGGTCTTCAGTT
CCCCGTTGGAAGAATCGGAAGGTTTTTGAAAAAAGGCCGATACGCTCAACGTGTTGGTTCGGGTGCTCCAGTTTACTTGGCGGCCGTACT
TGAATATTTGGCTGCTGAAGTGTTGGAGTTGGCTGGAAATGCTGCCCGTGACAACAAGAAGAACAGAATCATCCCAAGGCACTTGCTTTT
GGCTGTGAGGAATGATGAAGAGCTTGGGAAACTTCTTGCTGGTGTAACAATCGCACATGGTGGTGTTCTTCCAAACATCAACCCAATTTT
GTTGCCAAAGAAGACTGGAGGTGAAAAGGCCCCTAAATCTCCATCCAAAGCTACCAAATCTCCCAAGAAGGCATAGATTCTTAATGTTTT
TTTTTTTTTGGATCGTCTGTGTATGTAATTCTGTTGTTAGAAGGTGATGATTATCCTTGATGGAATTAGTTAAAACTACTGTTAGATCTT
ATTTTTCTCTATTATCAATCAATGAAACCCCTTGTTTCGACTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAANNNNCCCCCCCCCCAAGGGGCCCCTTTTTTTTTTTTTTTGGGCCCCCAAAAAAAGGGGGGGAAAAAAGGG
GAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (14)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	1
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	3
Solanum lycopersicum	LB	Leaf Mature leaves	3316	1
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	2
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	1
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	1
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	6
Solanum lycopersicum	cLER	leaf 4 weeks	5127	2
Solanum lycopersicum	cLEY	root pre-anthesis/pre-fruit loading	3259	1
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	1
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	1
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	1
Solanum lycopersicum	cTOS	suspension cultures	8026	1
Solanum habrochaites	LH_Ea	Glandular Trichomes	3840	4

mRNA member sequences (26)

Alignment image suppressed for unigene with 26 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (2)

Annotations (manual: 1 | blast: 2 | go: 7 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101377	Ras GTPase - Molecular Function: GTP binding (GO:0005525) - Biological Process: small GTPase mediated signal transduction (GO:0007264)	504
2	118521	Histone-fold Histone H2A - Cellular Component: nucleosome (GO:0000786) - Molecular Function: DNA binding (GO:0003677) - Cellular Component: nucleus (GO:0005634) - Biological Process: nucleosome assembly (GO:0006334) - Biological Process: chromosome organization and biogenesis (sensu Eukaryota) (GO:0007001) Histone-fold/TFIID-TAF/NF-Y - Molecular Function: DNA binding (GO:0003677) Histone core - Molecular Function: DNA binding (GO:0003677)	68
5	128935	Small GTP-binding protein domain - Molecular Function: GTP binding (GO:0005525) Ras Ras GTPase - Molecular Function: GTP binding (GO:0005525) - Biological Process: small GTPase mediated signal transduction (GO:0007264) Ras small GTPase Rab type - Molecular Function: GTP binding (GO:0005525) - Biological Process: small GTPase mediated signal transduction (GO:0007264) - Biological Process: protein transport (GO:0015031)	203

Preceding Unigenes (1)

Unigene	Build
SGN-U214809	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer