Notice: The contact form functionality has been restored. Apologies for any inconvenience.


This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U566850 in the current build, Tomato 200607 #2
Unigene SGN-U316255

Unigene Basic Information 
Unigene ID: SGN-U316255
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 316255
mRNA sequence: Length: 1364 bp

>SGN-U316255 Tomato 200607 #1 (29 members)
CCCCGGGCTGCAGGAATCGGCACGAGGCGAACAAGGAACGTGTGTGTGGCACGCAGAACATTCATAGTGAGACTTCCGATTTCTCCCTTT
CCTCCCCAAAATCTCCATTTTCTCCGACCACCGTCTGCTCGGAGCAATCGCCGGAGACTAAAAATGTTCGGTCGACTCGCTGCGCAACGT
CTGAACGAGATCCGAACGTCCATCCGCCGAACTACTCAGGCATCGCGATCTTTTTCCACTGCACTCAACTATCACATTGATACACCGGAC
AACAAAACGGACCTTCCTTGGGAGTTTAATAATGCAAACAAGGAAAAGGTGAAAGAAATACTGTCTTTCTACCCATCCAACTATAAACAA
TCTGCAGTGATTCCTTTGTTGGATCTTGCACAGCAGCAAAATGGAGGGTGGCTACCTGTTTCGGCGATGAATGCAGTGGCTAAGGTTGTT
GAAGTTGCGCCAATTCGTGTATATGAGGTTGCAACTTTCTACACGATGTTCAACAGGACAAAAGTTGGAAAATATCACCTTTTGGTTTGT
GGCACAACACCTTGTATGATCCGTGGTTCAAGAGGTATCGAAGAAGCTATACTGAAGCACCTGGGAGTAAAGCGCAATGAAGTAACTAAG
GATGGCTTATTTTCTGTTGGTGAGATGGAATGCATGGGTTGCTGTGTAAATGCTCCAATGATGACGGTGGCTGACTATTCCAATGGATCT
GAAGGATATGCTTACAATTATTATGAGGATCTCACTCCAAAGAAAGCTGTAGAGATTGTTGAGGCATTCAGGAAAGGTGAAAAACCACCG
CGCGGCACTCAGAATCCAGGTCGTATCAATTGTGGACCAGAAGGAGGAAATACTACATTATTAGGTGAGCCTAAGGCTCCTCCTTGTCGG
GATCTAGATGCTGCTGAATAAATTTCTTGTTGTTCAGTTTTTTAATAATGCAAAACAATGGATGGAGAGACGCATCCGATATCATATGCA
GTAACTTACCTACTGCATTGATGATATTTAAAGATTGTTTTCTGTCTGTCAGTATAATTACAGGTAAAACTGATTCTTGTTTGTTTTATC
GGTTTAACTCTTACCGGATCCAGTGAAAGTCCTTTGTTTTGGGTCAGGATGTAATGTTTTGCCTAGAATTGATTTAGTACAGAATGGTTA
GTTTACAATTAGGAAGTTTTTGATTTAAGAAGCCAATAGCTTTTCCAATCATTACACTCTAATACTCAAGTGTACTGGGAGGGAGAAATG
GCATTGTTGTTTGGCGTTTTGGATGTGAAAAGAGATTTTCTACTGAATAAATAAACAACTGGCATTCAAAGTTTCTTGTGAAAAAAAAAA
AAAAAAAACTCGAG


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (18)  
mRNA member sequences (29)  
Alignment image suppressed for unigene with 29 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (2)  
Annotations (manual: 1 | blast: 2 | go: 3 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (1)