Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U581532 in the current build, Tomato 200607 #2

Unigene SGN-U316508

Unigene Basic Information

Unigene ID:	SGN-U316508
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	316508
mRNA sequence:	Length: 973 bp

>SGN-U316508 Tomato 200607 #1 (4 members)
GCGTTAACTGGTGATATTGTTGCTCTTGCTGGATTGAAAGATACAATTACAGGAGAGACATTGTCTGATCCCGAGAAGCCTGTTGTGCTT
GAGCGCATGGATTTCCCAGATCCTGTTATAAAGGTTGCAATTGAACCTAAGACCAAGGCAGACATTGATAAGATGGCGCAAGGTTTAATA
AAACTGGCACAAGAGGATCCGTCTTTCCATTTTTCACGTGATGAGGAGATTAACCAGACAGTTATTGAGGGAATGGGAGAATTACATCTT
GAGATCATTGTAGATCGACTGAAAAGGGAATTTAAGGTGGAAGCTAATGTCGGAGCTCCACAAGTCAACTACCGCGAGAGCATTTCCAGG
AACTCAGAAGTAAAATACGTGCATAAGAAGCAGTCTGGTGGTTCAGGACAGTTTGCTGATATCACAGTAAGGTTTGAACCCATGGAAGCA
GGTGGTGGATTCTTTAGTTCCATTAGCAGAGATGTTCAATTACGTTAGTACCTTGCGAGGAATGACAAAGGGGCGTGCATCGTATGTTAT
GCAGTTAGCCAAATTTGACGTTGTCCCTCAACACATTCAAAACCAGCTTGCCAAAAAGGAGGAAGCAGCTGCTGCTTAGTCAGTCATCTT
CCAGATTTTGGATCCACAAACTTGAAAATAGGTATTTTTACTCGACGAAGATGTTAAGGCTTGGACAACATTCTTTTTGTACGTACCAGC
ATGGAACACCGATGGAGAATAGCTGATATTTAGTCATGCGTCTGAGTTTTTTCAGACGTTTGTGTATGTTGTTGAGTTATAAGCTGAGAC
TCCGAAGAGACGGAAGAAAGCAAGAAGGAAATGTGTATACATGCATTTAAGATGTCTCTACATCCCAAAGAAGCATCAATATTTTAGGGC
AAGATTGAGTGTGTCTCCGATTGTGGAATAATTTTCTTACTAAAAAATAAATATATGCTTTGTAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	LC	Leaf Mature leaves	5712	4

mRNA member sequences (4)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 1 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101378	Heavy metal transport/detoxification protein - Biological Process: metal ion transport (GO:0030001) - Molecular Function: metal ion binding (GO:0046872)	495
2	119664	Elongation factor Tu domain 2 - Molecular Function: GTP binding (GO:0005525) Elongation factor G III and V Translation elongation factor G - Molecular Function: translation elongation factor activity (GO:0003746) - Molecular Function: GTP binding (GO:0005525) - Cellular Component: intracellular (GO:0005622) - Biological Process: translational elongation (GO:0006414) Small GTP-binding protein domain - Molecular Function: GTP binding (GO:0005525) Translation factor Elongation factor G C-terminal - Molecular Function: GTP binding (GO:0005525) Elongation factor G domain IV - Molecular Function: GTP binding (GO:0005525) Protein synthesis factor GTP-binding - Molecular Function: GTP binding (GO:0005525) - Biological Process: protein biosynthesis (GO:0006412)	13
5	129999	Elongation factor Tu domain 2 - Molecular Function: GTP binding (GO:0005525) Elongation factor G III and V Translation elongation factor G - Molecular Function: translation elongation factor activity (GO:0003746) - Molecular Function: GTP binding (GO:0005525) - Cellular Component: intracellular (GO:0005622) - Biological Process: translational elongation (GO:0006414) Small GTP-binding protein domain - Molecular Function: GTP binding (GO:0005525) Translation factor Elongation factor G C-terminal - Molecular Function: GTP binding (GO:0005525) Elongation factor G domain IV - Molecular Function: GTP binding (GO:0005525) Protein synthesis factor GTP-binding - Molecular Function: GTP binding (GO:0005525) - Biological Process: protein biosynthesis (GO:0006412)	13

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer