This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U562989 in the current build, Tomato 200607 #2
Unigene SGN-U316757

Unigene Basic Information 
Unigene ID: SGN-U316757
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 316757
mRNA sequence: Length: 1958 bp

>SGN-U316757 Tomato 200607 #1 (21 members)
GAGTACCAGATGTTAGCATAAATTCGACACCAGCAATGGGTGCAGAGCATGGCTCTTCAGCAAGTCTAGAGCTTGATCTTGAACATTATG
TTGTCCCCGCTCCAGCAACATCTGCACCGGTTTATGCTGCTAACTTGACAGAAACTCCTAGGTCTCTAACACGTAAAGGGGTATTTTCTG
GGACAGATGGCACTATCATTCCAAGGCCTTCCTCAAAAGATGGTCACACTTCAAATGATCGGTCTGCTTCAATAAAGCAGATGGAAGTAA
TTGTTCCGGATCCAACTAGAGTCCCCTCAGGATCTGGTACGGTTGAATCCAAGTCCATGGGTGCGTTCTCGTCTTTGCAAAAGCAAGATA
GTTACAGGGGAATCCTTGTAGATAGGGGTGTGGGATCTCCAAGACTAGCCAAATCACCCAGTACAACCACTTTTACACTTGATCTCAAGC
CTGATTCAGATGCCAAGAATGTGATGCCAGCTGCTGCAGGAGCAGTTGCAGCTGGAGCTGTAGCTGATCAGATGCTTGGGCCAAAGGAAG
ACATGCATCTAGCAATTGTTCTGGTTGGCTTGCCAGCTCGTGGAAAAACTTTTACTGCCGCTAAGCTTACTAGGTATCTTCGATGGTTAG
GTCATGACACCAAGCACTTCAATGTTGGGAAGTACCGCCGACTCAAGCACGGAAGTAATCAGACTGCTGATTTCTTCCGAGCTGACAATC
CAGAAGGCTTGGAGGCTCGCAATGAGGTAGCTGCCCTTGCAATGGAAGACATGATCGCTTGGATGCAAGAGGGTGGTCAGGTAGGAATTT
TCGATGCTACAAATAGCTCAAGGAAAAGAAGGAATATGCTTATGCAGATGGCTGAGGGAAAATGCAAGATAATTTTCTTGGAAACCCTCT
GTAATGATCCTAAACTAATTGAAAGAAACATACGCCTCAAAGTTCAACAAAGTCCAGACTATGCTGAAGAGCCAGATTTTGAAGCTGGAT
ACAGGGACTTCAAGAATCGCCTTGATAATTATGAAAAAGTTTATGAGCCAGTAGAGGAAGGTTCTTATATTAAAATGATTGATATGGTCA
GTGGTCATGGAGGACAAATACAAGTAAATAATATTAGTGGCTATCTTCCTGGGAGGATTGTCTTCTTTTTGGTCAACACACATCTCACAC
CCCGTCCAATTTTGCTAACAAGGCATGGAGAGAGTTTGTACAATGTTAGAGGCAGAATTGGTGGTGACACTGCGATAAGTGAAACTGGGG
AGCTCTATGCAAAGAAGCTTGCCAATTTTGTTGAAAAACGACTGAAAAATGAAAAGGCCGCTTCTATATGGACCAGCACATTGCAAAGAA
CTATTTTGACAGCTAGTCCAATTGCTGGGTTTCCCAAGATACAATGGCGAGCCCTTGATGAAATAAATGCTGGTGTTTGTGACGGGATGA
CTTATGAAGAAATAAAGAAAAATATGCCCGAAGAATACGATTCACGCAAAAAGGACAAGCTGAGGTATAGATACCCTAGAGGCGAATCTT
ATCTTGATGTCATACAAAGGTTGGAGCCGGTGATTATCGAGCTTGAAAGACAAAGAGCACCAGTGGTGGTGGTATCCCACCAGGCCGTAT
TGAGGGCTTTGTATGCTTATTTTGCTGATAGGCCTTTGAGTGAAATTCCACACATAGAGATGCCACTTCACACAATCATAGAGATACAAA
TGGGGGTTACAGGAGTACAGGAGAAGAGATACAAACTGATGTAGGTCATTGCAACTTGACTTTCTAATACGTATATGCAGCAATAATTTC
AAAAAAAATAAAACAAATACGTATATGCAGCAATTCTCTCATTCAAATTGTAACAACCGATAACAAAAAAAATTGTATATCGACGAGTGT
TTGACATTAAAGTGTATCAATTTGAAGGCTTCATCTTCATCTTCTTCTTAAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (9)  
mRNA member sequences (21)  
Alignment image suppressed for unigene with 21 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (4)  
Annotations (manual: 1 | blast: 2 | go: 4 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (2)