Notice: The contact form functionality has been restored. Apologies for any inconvenience.


This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U576896 in the current build, Tomato 200607 #2
Unigene SGN-U317948

Unigene Basic Information 
Unigene ID: SGN-U317948
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 317948
mRNA sequence: Length: 2302 bp

>SGN-U317948 Tomato 200607 #1 (18 members)
TTCTAGTTGGAGCACACAACCAGGCTTTAGAATCAGTTTTAACAGTTGAAAGCTCAAGTTGGGTATTTGACCATGCAGTTACTGATGGTG
ATCTTGATACAGATAGTAACATAAATGCAGTTCCTCACGCTAAGCAGGATTCAGAAAACAATCTCTGCGTAGAGATAACAGAAAAGGATG
GCAGACTTGTGCAGGATGAGGAGAGAGAAAAAGGAAGCATTGGGAAGAATGTTTACATTTCTTACTTGACCATTGTGAAAGGTGGTGCCT
TTATTCCAATAATTCTTCTAGCGCAATCATCATTTCAAGTGCTTCAAATAGCGAGCAACTACTGGATGGCATGGTCATGTCCCACAGGTG
ATACATCACCAATAACAGGGAAGATGAACTCCATACTTTTTGTTTATGTGCTTCTCGCTGTAGGAAGTTCTCTTTGTGTGCTAGTCCGGT
CATCAGTTTTGGCTATAGTAGGCCTTCAAACCGCAGAAAAGCTCTTTAGCAACATGCTGCACAGCATCCTTCGTGCTCCTTTGTCATTCT
TCGACTCTACTCCTACTGGAAGAATCTTAAATCGCGCATCGATAGACCAAAGTGTTCTAGACTTGAAAATGGCAAACAAGTTGGGTTTGT
GTGCCTTCTCCATTATTCAGCTTCTTGGGACAATTGCAGTCATGTCGCATGCCGCATGGGAAGTATTTGTCATCTTTATTCCAGTAACAG
CAGTCTGCATTTGGTACCAGCAATACTACATACCAACCGCAAGGGAGCTTGCTCGATTATATGGAGTTCAAAGAGCTCCGATCCTCCATC
ACTTTGCAGAATCACTCGCAGGAGCAACAACAATTCGTGCTTTCAACCAAAAAGATCGATTTGCACATGCAAACCTTTGTCTCATAGATG
GTCATTCAAGGCCATGGTTTCACAATGTATCCGCAATGGAATGGCTTTATTTTAGACTCAACCAACTAGCTAATTTTGTTTTCGCCTTCT
CCCTTGTTCTGCTAGTCACACTCCCCGAAGGAATCATAAATCCAAGCATTGCAGGATTAGCAGTAACATACGGGATCAATTTGAATGTTT
TACAAGCTTCAGTTATATGGAACATTTGCTATGTTGAAAACAAAATGATATCAGTTGAAAGGATTCTCCAGTACTCTAACCTTGCCAGTG
AAGCACCTCTTGTGATTGAAAATAGAAGACCATCAATCACTTGGCCAGAAACTGGTACAATTTCCTTCCAAAATTTGCAGATACGTTATG
CTGAACACCTCCCTTCTGTTTTGAAAAACATAACATGCACATTGCCAGGAAGTAAGAAATTTGGTGTTGTGGGCAGAACAGGAAGTGGTA
AATCAACCCTCATTCAGGCTCTTTTCCGTATTATAGAACCCCAAGAAGGAAGCATTATTATTGATGATGTCGATATTTGCAAGATTGGCC
TTCATGATTTGAGGTCAAGGCTTAGTATTATTCCTCAGGATCCAACAATGTTCGAGGGAACAGTTAGAGGAAACCTAGATCCAGTTTCAC
AATACTCTGATACTGAAATCTGGGAGGCTCTGGACAAATGTCAACTTGGCAATATAGTACGTGCAAAGCCAGAGAAACTAGAATTTACAG
TGGTTGAAAATGGAGAAAACTGGAGTGTTGGTCAAAGGCAACTTTTCTGTCTTGGAAGGGCCTTGTTGAAGAAAAGCAGTATTCTTGTTC
TGGATGAAGCAACAACATCACTTGATGCAGTAACAGATGAAGTGTTGCAAAAGATTATCAGTCAAGAGTTCAGAAATCAAACAGTCATCA
CGATAGCTCACAGAATCCACAGAGTCATTGATAGTGATTTTGTCTTGGTCTTGAATGAAGGAAGAATAGCTGAATATGACACACCAGCAG
GGCTATTGGGAAGACATGATTCTTTATTCTCCAAATTGATAAAGGAGTATTCAATGAGATCAAAAAAATTAATAGCTTAGCTATATTACA
GACTTGATCTTCATTTCTACATTCTGCAAAAAGCAGTGAAAGAAGAAACAAATGATAACAGAAAGCTAAAGCTTTGATAAAAGCTGAAAA
ATCGATATTCTTATCACTATGCCATAGGATGTTGAAAATTATGTAAGCTTAGTTCAGTATAGTGAAAAACTGAACACAAAATGAAGAATA
CACACATCCCAGCATTGGAACTTTGTAAGATTTTGTAGACTTCGTTTTCGAAATTACCAATAATTATGTTCAATTCAAACTTGCAGTTTG
GGAGAGGTTATGTTGATGATGCATATATAATTTTTTGAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (5)  
mRNA member sequences (18)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (4)  
Annotations (manual: 1 | blast: 2 | go: 7 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (1)