This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U581493 in the current build, Tomato 200607 #2
Unigene SGN-U318256

Unigene Basic Information 
Unigene ID: SGN-U318256
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 318256
mRNA sequence: Length: 831 bp

>SGN-U318256 Tomato 200607 #1 (17 members)
CGGCCGATTCCCATGGGGATCCGATGACTTGAATGTTATCTGCAGTAGCCAAAAACAAAGTAAAAAATTAAACAGTGTTTTTTAAAAAAA
AAGAATTTTTGATCAAAGATGGCACAATACGGCAATCAAGACCAAATGCGCAAGACTGATGAATATGGAAACCATGTCCAAGAAACAGGA
GTCTATCAAGGTACCGGTACTGGCGGTATGATGGGGGGCACGGGTACTGGCGGTATGATGGGGGGCACTGGTGGAGAATATGGAACTCAA
GGCATGGGTACTGGTACTCATCACCATGAGGGGCAACAGCAGCTTCGTCGATCCGACAGCTCTAGCTCGTCGGAGGATGATGGAGAAGGT
GGGAGGAGAAAGAAGGGTTTGAAGGAGAAGATAATGGAGAAGATGCCTGGACAACATGAAGGTGAGTATGGACAAACAACAGGTGAAGAG
AAGAAAGGAATGATGGACAAAATCAAGGACAAGATCCCTGGGATGCATTGAACACCTTTGTTTTCATCTCCATCTTATCTTATGAATAAA
TAAGGTAGTGCTTGATTCTATTTCATGCACTAATTAGTAGTAATCGTTATGCCAGTAATTATCTAATTACGTACACTCTTGTGTTTAAAG
TCGTGTAAAGTGTGCTGACGCTATATACATGTGTGTGTATATTGGCGGCCATGCCCTGCCCCTTCTGTATTTTTAAAACAAGAATATTGC
TTCCATGCTTGGAAAGCAATGATCATGTTGATGTGTGTTATGGTGTCCCGTGTTTAATGATGTTTTGGAAATAATATAACTTGTGCTAAA
AAAAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
TAS14 TAS14 mRNA inducible by abscisic acid and environmental stress
Genomic locations (0)None
Library representation (6)  
mRNA member sequences (17)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (2)  
Annotations (manual: 1 | blast: 0 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (1)