Sol Genomics Network

Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U576465 and SGN-U576466 in the current build, Tomato 200607 #2

Unigene SGN-U318910

Unigene Basic Information

Unigene ID:	SGN-U318910
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	318910
mRNA sequence:	Length: 839 bp

>SGN-U318910 Tomato 200607 #1 (4 members)
GAACAAAAGTCAAGAGTTCAATTCTTGAATTTTTCTAATAGAAATGGCATCAACTTCTCTTTCTCTTAAGCTACAATTCCCCTCACATAC
ATCATCATCTTCTCGTAAAAATTCATCGTCTCATCGTGTTAGTATTCGTCCCATTCAGGCTTCGGTGTCTGAGATACCACCTTACATTTC
ATCACCATCACCATCACCACCACCGGTTAAACAAGCGAAACTCCCAGCCAGAAAAGTTCCTGGAGATTATGGACTACCATTAGTTGGTCC
ATGGAAAGACAGACTTGATTACTTCTACAATCAGGGCAAAAATGAATTTTTCAAATCAAGAATTCAGAAGCATCAGTCTACTGTTTTTCG
AACGAACATGCCACCAGGTCCATTCATTTCATTCAATCCAAACGTTGTTGTTTTGCTCGATGGTAAAAGTTTCCCCGTACTTTTTGATGT
ATCTAAAGTTGAAAAAAAGGATCTTTTCACCGGTACTTTCATGCCATCCACTGATCTCACAGGCGGTTATCGTGTTCTCTCCTATCTTGA
TCCTTCTGAACCAAACCATGCCAAATTGAAGAAACTCATGTTTTATCTCCTTTCATCACGACGCAATGAAGTTATTCCAGAGTTTCACAA
TAGCTACTCCGAGCTATTTGAAACTCTGGAAAACGAACTCTCCACGAAAGGTAAAGCTGGGCTCAATGCAGCAAATGATCAAGCTGCATT
TAACTTCCTGGCTAGGTCTTTATATGGCATTAATCCCTCAGACACCGAACTTGGAACCGATGGNNACTAGNTGATCGGAAAATGGGTGCT
GTTCCAGCTTCATCCTTTGCTAATTCTCG

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (3)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	1
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	2
Solanum habrochaites	cLHT	leaf trichomes 4-8 weeks old	2457	1

mRNA member sequences (4)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 0 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101962	Cytochrome P450 - Molecular Function: monooxygenase activity (GO:0004497) - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118) - Molecular Function: heme binding (GO:0020037) E-class P450 group IV - Molecular Function: monooxygenase activity (GO:0004497) - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118) - Molecular Function: heme binding (GO:0020037)	27
2	118907	Cytochrome P450 - Molecular Function: monooxygenase activity (GO:0004497) - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118) - Molecular Function: heme binding (GO:0020037) E-class P450 group IV - Molecular Function: monooxygenase activity (GO:0004497) - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118) - Molecular Function: heme binding (GO:0020037)	26
5	129313	Cytochrome P450 - Molecular Function: monooxygenase activity (GO:0004497) - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118) - Molecular Function: heme binding (GO:0020037) E-class P450 group IV - Molecular Function: monooxygenase activity (GO:0004497) - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118) - Molecular Function: heme binding (GO:0020037)	26

Preceding Unigenes (1)

Unigene	Build
SGN-U217795	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer