Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U574509 and SGN-U574510 in the current build, Tomato 200607 #2

Unigene SGN-U319518

Unigene Basic Information

Unigene ID:	SGN-U319518
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	319518
mRNA sequence:	Length: 882 bp

>SGN-U319518 Tomato 200607 #1 (11 members)
ATGATGTGAAACTATTAGGATCATGGCCTAGTACATTTGTTATGAGGCCTCGTATCGCGCTTAACGTAAAATCAGTGTGTTATGATTTCT
TGGAGGAACAGTTAAGTTCTAAGAGTGATCTTCTCCTTATATCAAATCCAGTTTACAAGAAAATTCCAGTTCTAATTCATGATGGGAAGT
CCATTTGTGAATCACTCAACATTGTTCAGTATATTGATGAAAAATGGACTAATTCTGGTCCCTCTATTCTCCCCTTGGATCCTTATGATC
GTGCCATTGCTCGATTTTGGGCATGTTATATTGACGATAAGTGGTTTCCATTATTCCGTTCCTTTGCGGTTGCCCAAGGAGAGGATGCCA
TAAAAACAGCACTAGAGCCAGTGTTCGACGGTCTGGTGTTGTTGGAAGACGCCTTCAAGAATTGCAGCAAAGGAAAGAAGTTCTTTGGCG
GAGACAAAATTGGATACGTGGACATTGCACTTGGATGCTTCTTAGGTTGGATGAGGGTGATCGAGAAGATGAACAACGTCACACTACTTG
ATGAAGCCAAGACTCCAGGTTTATACAATTGGGCTGAAGATTTTTGTGCTGATAGTTCTGTCAAAGATGTCATGCCTGAAACTAATAAGC
TTGCTGAGGCTGCTAAGAACCTTATACCCAAAATCAGAGCTAATGCATCTAGCTAAATCCACACGCCACGTTTAGCCTATGAAGCCTCGA
TATCTATTCTTAATCTCTAAAGTCTAGCTAAGACCATATATGGAAATAACATTTGGTATTGTGTAAAAAACTACTAAGAAATGAGTACTA
TGAAGCCAAGATCTACTATTTATAGGTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACTCGAGGGGGGCCC

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (8)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	1
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	1
Solanum lycopersicum	LB	Leaf Mature leaves	3316	2
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	3
Solanum lycopersicum	cLER	leaf 4 weeks	5127	1
Solanum lycopersicum	cLES	leaf 4 weeks	5243	1
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	1
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	1

mRNA member sequences (11)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 1 | blast: 2 | go: 0 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101396	Thioredoxin-like fold Glutathione S-transferase C-terminal-like	299
2	118441	Glutathione S-transferase C-terminal-like Glutathione S-transferase N-terminal Thioredoxin-like fold	150
5	128988	Thioredoxin fold Glutathione S-transferase C-terminal-like Glutathione S-transferase N-terminal Thioredoxin-like fold	79

Preceding Unigenes (2)

Unigene	Build
SGN-U218997	Lycopersicon Combined #3
SGN-U234114	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer