This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U567643 in the current build, Tomato 200607 #2
Unigene SGN-U321852

Unigene Basic Information 
Unigene ID: SGN-U321852
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 321852
mRNA sequence: Length: 768 bp

>SGN-U321852 Tomato 200607 #1 (8 members)
AAAAGAAAGGGTTTTTAGGGTTTAAGGATTCTTCAGTTTTCCACGCTTTGACGAAGGAACCATGTGGGCAGTTCGTCGAGCGTCTTCTTC
CTTCAAGAAACAAGTATTTATAACCGGAGGCTCTCGAATATGTTATTCCACTCTAGATATTACAAGTCACTGCCTGAAAGGACACAATGA
TGGGCTTAAAGGGGATTCCAATGTAATATCACATAGAGCTCTTACACTTGGAGGATACCAAATAACATCTCATGGTTTTCTAAGAGTATT
CAAGGAAAGCCGAAGTTTTTCTTCACAAGCTGGCACAAAGAGCAGTGGAGAGGAGGATAGTAATTCAGACGATGGATTTTCAGAGCTTGA
ATCTTCTAGTGCAACTGAGGCAATACAAGAAGTCAACAAAGTTGATGAGTCAGTCTCTGAGCATGAGATTTCCGATGAGGATCTTGATGG
TGAAGATGTGGAAGCACCTCAGGAATTATTGTCTGATACCGAGGCTGAGATTAACAAACGGAAGTCTCCAAGGAACGGAGTTTCTTCAGC
ATTATTCAATGCTGTCATGGCAGCACCAGCTTTACGTGTTAGTAAAATCATGGATAAATGGGTTGAAGGAAATAACGTCACACGGGTAGA
AGTAGCATCAGCGATGCTTAATTTTCGTAAAAGGCGCATGTACGGGAAGGCACTGCAGCTCTCTGAGTGGTTGGAGTCAAGCAATCAGCT
CACTTTTATTGACAGAGACTATGCTTCTCGTGTTGATTTAATTGCCAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
DQ117941 DNA-binding protein DQ117941DNA binding
Genomic locations (0)None
Library representation (7)  
mRNA member sequences (8)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (1)