Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.


This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U570620 in the current build, Tomato 200607 #2
Unigene SGN-U324260

Unigene Basic Information 
Unigene ID: SGN-U324260
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 324260
mRNA sequence: Length: 1717 bp

>SGN-U324260 Tomato 200607 #1 (6 members)
ATAAACATAATATTAAATAGTCATAAACCATATGTTAAATAATAATAATAATTAATTAATAATAACAATATGGCTTGTTCAAAGAATATT
TGGGTTATTGTTATATTCTTTTTGTGCATTTTGGCTGGTCCTATTATTGCTCAAGATTACAATGATTCACTTGGCAAAGCTATTTTATTC
TTTGAAGGGCAACGTTCTGGAAAATTACCAGTTTCTCAAAGAGTCAAATGGAGAGGAGATTCCGCACTCATCGATGGCATAATTGAACAT
GTGAATTTGATTGGAGGCTACTATGATGCTGGTGACAATGTAAAATTTGGATGGCCCATGGCTTATTCTTTAACCTTGTTGAGTTGGGCT
GCTATTGAATATCAAACACAAATCTCTTCAACAAATCAACTTGTACACCTCCAAAATGCAATTCGTTGGGGCACAAATTTCTTAATTCGA
GCCCATACTTCAAGTACAACTCTCTATACTCAGGTTGGAGATGGAAATGCAGATCACCAATGTTGGGAAAGACCAGAAGACATGGATACT
CCTAGAACACTATATAAAATAACATCAAATTCTCCAGGATCTGAGGTGGCAGCTGACGTGGCAGCTGCTTTTGCTGCTGCTTCAATAGTT
TTCAAAAATATTGATTCCAACTATTCTACAAAGTTATTAAAAAGATCAAGATCCTTATTTGCATTTGCGGATAAGTATAGAGGATCTTAC
CAAGCTTCTTGTCCATTCTATTGTTCCTACTCAGGTTATAAGGATGAATTGTTGTGGGCTGCTGCTTGGCTATATAAGGCAGGTGGAGGA
AACAATTATTTAAATTATGCTTCAATCAACCAAGGTTGGAGTCAAGTTGCCTCTGAGTTTAGTTGGGATGACAAGTTTGCTGGAGCCCAA
ACTTTACTAGCTAAGGAATACCTTAATGGAAAGAGCAATTTGGAAAAATTCAAGAAAGATGCTGATTCATTTATTTGTGGATTAATGCCA
GAAAGTAGCTCTATACAAATTAAGACAACCCCAGGTGGACTTTTGTATTATAGAGATAGTAGCAATTTGCAATATGTGAATGGTGCCACT
ATGGTACTTTTTATGTACACTAAAGTCCTTGAGGCAGCTGGAATAGGAGGAGTTACATGTGGATCTGTTAATTTTTCCACATCCAAGATT
AAAGCCTTTGCAAAATTACAGGTTGACTACATACTTGGAAACAATCCACTCAAAATGTCATACATGGTGGGATTTGGCAACAAATATCCA
ACAAAACTTCACCATAGAGCCTCATCACTCCCTTCAATTTATAACCATCCAACTAGGGTGGGGTGCAACGATGGCTATAGTTCATGGTAC
AATTCTAACAATCCAAACCCTAACACACATGTCGGTGCGATCGTCGGTGGGCCTAATTCCGGGGACCAATTTATTGATTCGCGATCAGAT
TACTCTCATTCTGAACCCACGACTTATATGAATGCAGCATTTATAGGGTCCGTGGCCGCTTTGATTGATCAAACCAAAGAAGGAGAACAC
TATGGGGAAATTAATTCACAATTTAACAAAACAGGTTTTATGTGATAGATAAATTAGTAAAGTAGTGAATGTCATGCAATATTGATAAAT
ATATGTACATATAATGAATTATCATAAATGTATGAAGCTATAAATATTACATAATAGAAATAAATAAATATCAAAAATGTATCTTTTTTT
TTTTTTT


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
cel1 LEU13054 endo-1,4-beta-glucanase precursorcell wall hydrolase
Genomic locations (0)None
Library representation (6)  
mRNA member sequences (6)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 1 | blast: 2 | go: 3 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (1)