Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.


This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U564580 in the current build, Tomato 200607 #2
Unigene SGN-U325875

Unigene Basic Information 
Unigene ID: SGN-U325875
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 325875
mRNA sequence: Length: 1313 bp

>SGN-U325875 Tomato 200607 #1 (4 members)
GTTTCCTATAGGAAGATGAATCCTTTTTGTGTCCCATTTGCAACTACAAACATGGGTTCTGCCATGCTTGCCATGGACCTGGGATGGATG
GGTCCAAATTATTCAATTTCAACAGCATGTGCAACAAGCAACTTCTGCATATTGAATGCCGCTAACCACATCATTAGAGGTGAAGCTGAC
ATGATGCTGTGTGGTGGATCAGATGCAGCAATTATACCAATTGGATTGGGAGGATTTGTTGCTTGCAGAGCACTTTCACAGAGAAATACC
GACCCTTCAAGAGCTTCTCGGCCTTGGGATAGTAATCGCGATGGATTTGTCATGGGTGAAGGAGCTGGTGTCCTGCTTCTGGAAGAACTT
GAGCATGCCAAGCAAAGAGGTGCAACAATCTATGCTGAATTTCTAGGTGGAAGTTTTACTTGTGATGCTTATCACATGACTGAGCCTCAT
CCTAAAGGAACTGGAGTCATCCTATGTGTAGAGAAGGCATTAGCTCAGTCAGGGGTATCCAAGGAAGATGTGAACTACATTAATGCGCAT
GCAACATCCACACCAGCAGGAGATCTTAAGGAGTATCAAGCTCTTGTTCATTGTTTTGGCCAAAATCCAGAGTTGCGAGTTAACTCCACA
AAATCTATGGTTGGTCACCTGCTTGGAGCTGCTGGTGCTGTTGAGGCTGTGGCAACTATCCAGGCAATACGAACTGGTTGGGTTCATCCA
AATATTAATCTTGAAAACCCAGATGAAGGCGTGGATACAAATATACTTGTTGGTCCCATAAAGGAACGACTGGATATTAAGGTGGCATTA
TCTAATTCATTTGGATTTGGTGGCCACAACTCATCAATCTTATTTGCTCCTTACAAGTAGATCTCTCAAACAATGTTGATGCATCTGACA
GATACAAGGAATATTTGGAAGGATCCTTGATTCCCAGAGTTACTTGAAGGACACTCGTAGAAGAGGCCTCAGTCTCGAAGAATTTGTTTT
CAGGAAGATAGTCTAATGACGGGGGTACTTCCCTCTGATATACAGAATTTGATTGTTGGAGAAAGAAGATGCCGAAGCAAAGAATGGGGG
GAGGATCAAGTTTTTTTTATCTCCATTTCTTTTAGCTAAATTATACTTACTTAACTAAATTGTTTCTCTTACACATAGCAGCAAATGACC
CTTAGGTGTTTGCATATGGGCCTTAATGCTAGTGTACTAGTTTCTTTGTATACCATATATATTTTGCAAATTGGACTTCTTGATATTTGA
ATGAAAAAACTCTGAAGGACTTCCTCAAAAAAAAACCCCAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (4)  
mRNA member sequences (4)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (1)